Detailed Information [104060]
 

Strain Information
DGRC Number 104060
Genotype with FlyBase Link w[*]; P{w[+mW.hs]=GawB}sfl[NP2002] / TM3, Sb[1] Ser[1]
Genotype w*; P{w+mW.hs=GawB}sflNP2002 / TM3, Sb1 Ser1
Break points/Insertion Site 65B4
Map Viewer
Related Genes CG18769 CG32396 sfl
Original Number 2002
Chromosome 3
Comments FlyBase Insertion: P{GawB}NP2002

NP line. Received from the National Institute of Genetics.

Balancer TM3 Sb Ser
Cluster id 1794
General Information NP_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Embryonic Expression cns
Larval GFP sg
Larval X-gal sg, weak epi
Adult GFP internal
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2020-04-03
Research papers using this strain
[Please submit your publication]
Tastekin I, Riedl J, Schilling-Kurz V, Gomez-Marin A, Truman JW, Louis M.
Role of the subesophageal zone in sensorimotor control of orientation in Drosophila larva.
Curr. Biol. (2015) 25(11) 1448-60 [PubMed ID = 25959970] [RRC reference]

Kain P, Dahanukar A.
Secondary taste neurons that convey sweet taste and starvation in the Drosophila brain.
Neuron (2015) 85(4) 819-32 [PubMed ID = 25661186] [RRC reference]

Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np26535_0807
Strand Plus
Insertion Point 6507289
Chromosome Band 3L
Flanking Sequence
tttggngcactgaacttaagtgtatacttcggtaagcttcggctatcgacgggaccacct
tatgttatttcatcatgGTGTGAGTGATTTGGGACGACAGACAGGACGACGAAGGAGCTG
CACACATCCCTTGCTGCTTTGAGTGAAGGATTAATGAACATATGTGGCCATGGGTTGTGG
GGACAAAACTCCTCGCTTTTTCTTCGTGCGAAGAATATGTGTAGGTGTATGTGTATGTGT
AAGTGTATGTGTGCGGCACTTTGCGGCCGCTAAAAGTGCACTTTGCTGTACTGCGATTTC
GTCGGTATGCCAGCTGTTGTCAGTTGACAAGGAAAACGATTTGCCGCTCCGGATTTTTCT
AGGCCAACAAACACACGGAAAGTACACAAACGAATGGGAATGGAGATGGACAGATGGACT
ACTTTGTGAGGCATTCAACTGGAGTAAATGGGAAATATATCAGGGGGAGTTGGAGTTGGC
CAAATAAAAGTGCCTGTAAGCTGGGGAAATTTGTTTCCTGACGAGATTTCACGATGATGG
NGGGAGAAAAACGATTACCGTTCGTGGATGTGGGTAAAAAAAGGGTTATATTAGCGGCAG
TGGNAATGGTGCCTTTTCATTTGGGGAGAAAAAAAAAACCTTAAANGGTCNNANAATTCN
TTNGGAGAGAACCCGNNCCCAANAACCCCTTATTGTNGGGGNCCCGTTTTCANGAANGGG
GAAGCCATCCCNCATNTTATTCTTTTTANACCCAAANAAATNCATTGAAAAGCNNNCCCT
GGGCCTTAAAATCCAACGGAatttggggagtttttatgaagagcctggccnnnnaaatnn
anacaannaacntggntttgaccctttggtaccacctctttnccgnggangaaggnncnn
cttattttttgctgncnnaaaggtaaaggcatttagntcctgcnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn

CLOSE