Detailed Information [104104]
 

Strain Information
DGRC Number 104104
Genotype with FlyBase Link w[*]; P{w[+mW.hs]=GawB}CG2991[NP2144] / CyO
Genotype w*; P{w+mW.hs=GawB}CG2991NP2144 / CyO
Break points/Insertion Site 23B6
Map Viewer
Related Genes oho23B CG2991
Original Number 2144
Chromosome 2
Comments FlyBase Insertion: P{GawB}NP2144

NP line. Received from the National Institute of Genetics.

Balancer CyO
Cluster id 1011
General Information NP_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Embryonic Expression scattered cells, AS
Larval GFP sg
Larval X-gal oenocyte, mt
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2020-04-03
Research papers using this strain
[Please submit your publication]
Tastekin I, Riedl J, Schilling-Kurz V, Gomez-Marin A, Truman JW, Louis M.
Role of the subesophageal zone in sensorimotor control of orientation in Drosophila larva.
Curr. Biol. (2015) 25(11) 1448-60 [PubMed ID = 25959970] [RRC reference]

Kain P, Dahanukar A.
Secondary taste neurons that convey sweet taste and starvation in the Drosophila brain.
Neuron (2015) 85(4) 819-32 [PubMed ID = 25661186] [RRC reference]

Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np32605_0907
Strand Plus
Insertion Point 2849852
Chromosome Band 2L
Flanking Sequence
gnnggnngggngggnnnngccaagggnnngnnnngnnnngttttggnnagggtttttngg
cgtgacantgccanttngtgtatacttncggtaagcttcggctatcgacgggnaccacct
tatgttatttcatcatgCTGGGGGCCAAACGTGACGGTGCTGTTGTAGTTGTAGTAGTTT
AGGGTACAAGCAGTCGGTTGGTACCACAACAACATAACGAAAACGGAATCCAATTGGAAA
CGGAAACTGCGCGTCCTTTAAAATATGTGACAAAGAACAACAAAGAGGCAACAAATTGTT
AAGCAACTTGCTCAGTTACAAGAATATATAAATGTGATGCAATAGCATAACCATTTCCAC
ACGGACGGCACAGCAACTTGGACAGTATTAGGCAGACTTCGTAACTAGCATATTTTCGCA
AACAGTACATGGTGAGTAGTTCCTTACCTTATAGAGCATTACGTACTAATGTACATATGC
ATGTACGTACGTATGTACATTCATGTGCACCCCAAAGCATAATAATCCCCTTACTTTTCG
CCGTGTTTTCCATTCTCGCGTTGTCGCGTGCTGAATTCCTGACTCACTAACGAGCCGTTC
CAGGTGCACGGTCCTCAGTGATAATGGCGAAAAAACCTATTTCCATTTACATTAGCTGAA
GAATCATTCGGTCTTAGAAGTTATTTTCGCAATTGGCATTGATTACTTTTGAATTGTTTT
TGCTGTATCCTAAAAATGCCGNGCCTCATAATAAATATTCAATAATATATTACAATATAT
ATCGGTGCCAAAAACCAAACctataacagncaataaaaaatntaaataaaactaaatagg
ggcggggcaattgcttacataaaaccttgacatttnaaggngngctgnttttggcccact
gggcgccgnccactttccgnccggggcacttgcacccaaatggactnaatttgcaccggg
cgcctttccttttcttcggttttctggcccatgcttttggccgggtnatttgcn

CLOSE