Detailed Information [104219]
 

Strain Information
DGRC Number 104219
Genotype with FlyBase Link w[*] P{w[+mW.hs]=GawB}NP2492 / FM7c
Genotype w* P{w+mW.hs=GawB}NP2492 / FM7c
Break points/Insertion Site 8E1
Map Viewer
Related Genes CG12667 lz
Original Number 2492
Chromosome 1
Comments FlyBase Insertion: P{GawB}NP2492

NP line. Received from the National Institute of Genetics.

Balancer FM7c
Cluster id 239
General Information NP_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Embryonic Expression amx
Larval GFP weak
Larval X-gal gut
Adult GFP internal
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2020-04-03
Research papers using this strain
[Please submit your publication]
Zhao B, Sun J, Zhang X, Mo H, Niu Y, Li Q, Wang L, Zhong Y.
Long-term memory is formed immediately without the need for protein synthesis-dependent consolidation in Drosophila.
Nat Commun (2019) 10(1) 4550 [PubMed ID = 31591396] [RRC reference]

Phan A, Thomas CI, Chakraborty M, Berry JA, Kamasawa N, Davis RL.
Stromalin Constrains Memory Acquisition by Developmentally Limiting Synaptic Vesicle Pool Size.
Neuron (2018) [PubMed ID = 30503644] [RRC reference]

Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np23565_0807
Flanking Sequence
aaagtttttttggnnngactaactantngttaaaaaacccaattntttggggacnnncgg
aaagcctcggctatcgacgggnaccaccttatgttatttcatcatgGGTGGTTACATTAC
TGTCGTGCTTACCGTTTTTTTTTNGGGGGGGNGTTNCTCTGGNCTTTCCCNCTTTTTTTG
GCNANAGTNAATGGGAGGGCTTTTTTCCCTTGGATTTTGGGGGGTTTGGCNCNNACTNGG
GGGGGGNNCTAAANAGCNNGTTTNCNNGNGGGGGGGGNGGCCGGNCGTCCCCCTNCGTTG
GATTTNGNGGNANCGGAATTAATTTGGGTTNATTGGGGGAAAANNCCCCCCCCCNAAAAA
NANGGGCNAANAAAACTNAATTTAAACCGGNGGGGCATNGGAGGNAAATTCCCATTGAAA
GNAGNNNAGGNNCCGGNACCCTTANATTNANAAANNTAAACCCGGGNGGCAAGCTNAACC
NGGGNCAAAGNGNNACGGCAAACGGAGGGGGATTTTTGGNTNAAATATTGGGGCTNAAAA
NTCAAGGCAANGGGGGGGGNGGGGGGGGGGGAAAAAANANNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnanaanaan

Library Name / Clone Name np / np60243_0309
Strand Plus
Insertion Point 9044970
Chromosome Band X
Flanking Sequence
antncttggngcgcanaaacccgcaagtttacgttaagtggatgtctcttgccgacgggn
accaccttatgttatttcatcatgTAACCACCCACAAAAAAGAGAAAGAGAGAGAGAGAG
TGGCGGTAGCAAAGCAAAGAGAAACGGTGAACTAAGAGACTTTGTTCAGAAGAGAGTCGC
TTATTCTCAAATGTTTGATAAAAATTATTTATGAATTTTCAGATTTATTTNNTTATTGAA
AGGGTTTACATTTAGAAATGGTTAATATTACTATATATATATAAATAATGATGCCCGGTA
ATAACTCTTATTTGAAAAAACTCTCTTCCACATTCAGCGCCGCTCTTCTCTCCGCTAAAC
TTTATTGTCAGCTAAACGGGGAGTAAAAGGCCCAAAGTGAATCATTCGATCCTCNNNCNG
GCGGCNTNGGCCACTAGNGGATCTGGATCCTCTAGCTAGAGCCTTTGNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNCNNCNNNNNNNNNNNNNNNNNNNNNNGNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnn

CLOSE