Detailed Information [104553]
 

Strain Information
DGRC Number 104553
Genotype with FlyBase Link w[*]; P{w[+mW.hs]=GawB}NP3596
Genotype w*; P{w+mW.hs=GawB}NP3596
Break points/Insertion Site 70D4
Map Viewer
Related Genes CG7906 F-element{}994
Original Number 3596
Chromosome 3
Comments FlyBase Insertion: P{GawB}NP3596

NP line. Received from the National Institute of Genetics.

Cluster id 1900
General Information NP_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Embryonic Expression cns midline, oenocyte (TU), sg (24-O-6)
Larval GFP sg
Larval X-gal crescent in antenna, sg
Adult GFP internal
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2020-04-03
Research papers using this strain
[Please submit your publication]
Tastekin I, Riedl J, Schilling-Kurz V, Gomez-Marin A, Truman JW, Louis M.
Role of the subesophageal zone in sensorimotor control of orientation in Drosophila larva.
Curr. Biol. (2015) 25(11) 1448-60 [PubMed ID = 25959970] [RRC reference]

Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np34375_0907
Strand Plus
Insertion Point 14194570
Chromosome Band 3L
Flanking Sequence
gtgcactgaatttaantgtatacttcggtaagcttcggctatcgacgggaccaccttatg
ttatttcatcatgATTTGGAAAATACAGCGAGTAAGCTGTGTGAGAAAACTTTAGATTGC
CGCCAAAAGCCACAAGATAATTAAATACTGAAAATTGAAATAATACTAAAAGATAACTGT
ACCACTAAAAAAAACTTAGATTGCATTGATATGCCCGAAAGGACATTACTGTTACTGTGC
ATTTTTAAAAATAGGTCCATATTCATTGCTAAATTAAGGACACTACCGTGGACGCTACGG
TAGATTCAATATTTTTCGAATACTTTAAAATTTCCTTAGTGTGACCCGTAGTCAACAAAA
AATCGTTGGCGTTATGCAATTCAAGTTGTCTTCTTGTGTCACACGTGTTCTTTCTTTGAA
ATCTGACTCCGACTTCGTTTGTTATAAATAAATCCTAAAATGGACAGTGAAAGGATAGTA
AACAGCCATTCTATTGAAGATGCTTCAGGGAACGATGAATTGGTAAGATTCGTCTGCCTT
TGTGATAGATATTCGCCTAGAAAACCATATTTCCATTTCAGCCGAGCAGTAGTTCGAATT
TTGAAAGACGTATACTCGGCGGGTCCTGGAGCACACGGCNTTNATGGGGAAGAGAATTTT
TTGGCAGAATTATTACCGAAAAGCAAAAAAAGGGAATTNTTTTATGATTGAAATGNAAAG
GAAATTTCCTGTTCCTAAATAGNNGACTCAAAGAACATGAAAAGNTTTTAAAGGATNTGA
TTCCGAAGAATTCCTTAGGAgggaacccgtcgcccaaanaanccatttttgtggggggnn
cctttttcaggaangggcaagcccttcccgaatgttattcctttttnagaccaatcaaat
ncctggaagagcttnccttgggcatnaaatccan

Image Files
Disc

d1 (->Large)

CLOSE