Detailed Information [104694]
Strain Information
DGRC Number 104694
Genotype with FlyBase Link y[*] w[*]; P{w[+mW.hs]=GawB}NP4486 / TM6, P{w[-]=UAS-lacZ.UW23-1}UW23-1
Genotype y* w*; P{w+mW.hs=GawB}NP4486 / TM6, P{w-=UAS-lacZ.UW23-1}UW23-1
Break points/Insertion Site 76B3
Map Viewer
Related Genes CG32207 CG9472
Original Number 4486
Chromosome 3
Comments FlyBase Insertion: P{GawB}NP4486

NP line. Received from the National Institute of Genetics.

Balancer TM6UW23-1
Cluster id 1987
General Information NP_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Embryonic Expression a small # of cells
Larval GFP cns
Larval X-gal epi, mg
Adult GFP internal
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Gallio M, Ofstad TA, Macpherson LJ, Wang JW, Zuker CS.
The coding of temperature in the Drosophila brain.
Cell (2011) 144(4) 614-24 [PubMed ID = 21335241] [RRC reference]

Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request
---

Library & Clone Information
Library Name / Clone Name np / np14535_0727
Strand Minus
Insertion Point 19431007
Chromosome Band 3L
Flanking Sequence
atcactnnggtaaaaaaccccctttttgggnctnncggnaanccccggctatcgacggga
ccaccttatgttatttcatcatgGAGCCAACTTCGTCCTGCCAGGCTTTTGGGTTAAAGT
TTCCACAGAGAAACGAAGTCTCGTCTATGTGTTAGGTATCTTTGCGGACAGGATTCGTGG
CAGGATTTAATTCATACCTCGAGTGCCGTGTCCTTTNTTTTTNTCCAAGGNTAAAGTGCC
TGGGTGCAGCGCCAAAGCGCGTCACTCCCTCGAGGTCCTGAGTCCTGGAANNCCATCAGA
GGAGGNGCCGTGGAGGGAGTTTTGCACCCCNGCNGGGGNTCGGCCGNTNCCGGTTTNCTT
TTGGGTTTNATGGTTNCCCNCCNCTNTGGCACCGANTCTTCCCNCCCGAAAAAANATGGC
CCCCANGCCCCCCACCCNAANATTTAAAAGGAGGGGGCTNCATAAACNAATTGGCCGGGG
AAAATAAAAACNNNNGGCTCNTTTGNTCNTGGGGCCCCCTCAAANNTNAAACCCCTNAGC
CCTTANAANCCCCACCGGAAAAAAAGGCCCCGGATAAGGAAAATTTTTTNCNCCNAGGGN
GNGAGANNGAACCCGCGNACCGAAATAAAAAAAANAGGGGNNGGCCCCCCGCNCCCNAGA
GNAAAAAAAAAAGGGTGGGCCNCCCCCNAAAACGGGTTANATTANNACANANGGNNCCCC
CCCNGCGNNAANAAGGGNGNGNGGTTAAAAANANNCCNGCNCNCAANGNTNNATAAAGCC
CGNCCCGCCCCTTNGGGNGNtatattntttaaaancgaaanacccccnncnaanacncca
nncnnggtnatatnnanacannngngtntntgggccntaaaatttntngncccccaattt
nttntttttttttnnggggggggggngggngnnaccnnannnnagggggngggggnngnn
nggggnccnnnnananagnnnnnnggnnnnnnnantnngngnnnngnaanaannnaangn
nnccncagannnnanaanaan

Library Name / Clone Name np / np31595_0907
Strand Minus
Insertion Point 19431007
Chromosome Band 3L
Flanking Sequence
ctnttnggtgcactgaccttaagttttttacttcggtaagcttcggctatcgacgggacc
accttatgttntttcatcatgGAGCCAACTTCGTCCTGCCAGGCTTTTGGGTTAAAGTTT
CCACAGAGAAACGAAGTCTCGTCTATGTGTTAGGTATCTTTGCGGACAGGATTCGTGGCA
GGATTTAATTCATACCTCGAGTGCCGTGTCCTCGGTGTTCAGCCAANGTTAAGTGCTGGT
GCAGCGCCAAGCGCGTCACTCCTCGAGTCCTGAGTCCTGAATCCATCAGAGGAGTGCGTG
TAGGAGTTTTGCACGCCGCCAGGGGTTCGTCGTTCCGTTTTCTTTTGTTTTTATGTTTCC
CGCCACTTTGGCACGATTCTTCCCACCGAAAAAATAATGTCCCCATGCACCCCAACCAAG
ATTTAAAGAAGGGGCTCATAAACAATTGCCTGGAAATATAATACATCGGCTCTTTGTTCT
GGTCCCTCGAACTTTTAGCCTTAGCCTTTAATCCCCACCGAAAAAAAAGCCCGCATAATG
AAATATTTTCCTCAGTGGCGAGAATGAACCGCGAACGAATTAAGAAAATGGCGTTGACTN
CGTCCCAAGTAAAAAAAACAGCTGAGCCGCCCACAAAACGGNATAATTAGACATTGGTAC
NCCCAGCGAAAAAAGGTAGCTGGATATAAATGACTTGCCAACGTTTTAAAGCCGCGCTGN
CTTTGGNGNTNATTTTTTAAACCGAAAACTNCCCGTTAAACCAAACCTGTTTAATTACCC
GACACGTTTTTGGCCTAAACttttttgccaatttttttttttttttnggggggggggggg
ggaaacccccaaagggggggggggggggggggggncnnaaaaaaaaaaanggggnnaaaa
tttngggnnaaaaaannnangncccccnggnnngnnaaanggggaaaantnnttttnaaa
aaaacctnggggccngnggggggggncaaaaaantggccn

CLOSE