Detailed Information [105275]
 

Strain Information
DGRC Number 105275
Genotype with FlyBase Link y[*] w[*]; P{w[+mW.hs]=GawB}CG1021[NP6590] / TM6, P{w[-]=UAS-lacZ.UW23-1}UW23-1
Genotype y* w*; P{w+mW.hs=GawB}CG1021NP6590 / TM6, P{w-=UAS-lacZ.UW23-1}UW23-1
Break points/Insertion Site 83E6
Map Viewer
Related Genes CG1021 CG10272 CG10277
Original Number 6590
Chromosome 3
Comments FlyBase Insertion: P{GawB}NP6590

NP line. Received from the National Institute of Genetics.

Balancer TM6UW23-1
Cluster id 1359
General Information NP_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Embryonic Expression retest. pattern identical to 6589. btl-like. ventral midline of CNS in stg 11 and uneven stain in all tracheal cells.
Larval GFP gut, fb
Larval X-gal sg, fb, gut, mt, epi
Adult GFP internal
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2020-04-03
Research papers using this strain
[Please submit your publication]
Hopkins PC.
Neurodegeneration in a Drosophila model for the function of TMCC2, an amyloid protein precursor-interacting and apolipoprotein E-binding protein.
PLoS One (2013) 8(2) e55810 [PubMed ID = 23409049] [RRC reference]

Kain P, Dahanukar A.
Secondary taste neurons that convey sweet taste and starvation in the Drosophila brain.
Neuron (2015) 85(4) 819-32 [PubMed ID = 25661186] [RRC reference]

Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np38785_0907
Strand Minus
Insertion Point 2231200
Chromosome Band 3R
Flanking Sequence
ttttttggggcactgancttatttgtatacttcggtaagcttcggctatcgacgggacca
ccttatgttatttcatcatgCAGCAGCCAAAAAGCGAGAAGAGAGCGCAAGGCAGAGAGC
GTGCAAAGCGGTCAGCGAGAGAGCGGGTGGCTGCTGCACCTTCATAACTGTTGTTGCAAA
GGTGAGTGCGTGCCGAATATTGTTTTTGGTTCAGAATTGTTTATTTAAGTGTACTCTCAA
CCAGGCCAACACACTCACAACCACACGCCCGCACGTACCTGCGACCCACGAACGTGTGTG
TGCGTGTGTGTTGGCCTGCCTGCTTATTTTTTATGCGGAAAAAACATTTGATCCAAAAAN
CNANGNGNNATCATCNCCTNATATGGGCCGNGGGCCCGNAAGGCGTTAGANNTCGGGGGA
CGACNCNGGGNNCNATTTTATAGACCCTTGGNATCATAAAAAGNACCGGCAGCCTAGAAC
CCCATTATTTTTGGGTTNCCNTTTGGAGGCAGGGNAGNCTTTCCGCCAAGNNATCTTTNC
AANACAACNNAATTCANGAANAGTNTNNCTTGGNCTTAAATNCNAACGGAANCNNTGNGG
TTNTNTGNTGGANCTGNCCCGTCAATAGNTACATTCACCTGTATAACCCCTTGGTTTATT
CCTTTNTTTNCNATTTGAATGNCANCTTTATTTGNTNCCTGNCTCNCGGTTGGAGGNTTG
TCAATTCNCCAATGAANNTNNTTNNNNNGGNNNNCNNNNTTNGNNNNNTNNGGNNNNAAA
NNTTTTNGNNNTTNGGGNTTggnnannnnnnntttttnncttttttaannnnnnnngnnt
nnttttnnnntttngntnnncncttnnnnnnnnnnttnnnnntnnccnntttttnnnntn
tnnaaanccaaaaacnan

Image Files
Embryo

e1 (->Large)

e2 (->Large)

CLOSE