Detailed Information [105356]
 

Strain Information
DGRC Number 105356
Genotype with FlyBase Link w[*]; P{w[+mW.hs]=GawB}Ent2[NP7068] / CyO, P{w[-]=UAS-lacZ.UW14}UW14
Genotype w*; P{w+mW.hs=GawB}Ent2NP7068 / CyO, P{w-=UAS-lacZ.UW14}UW14
Break points/Insertion Site 26E3
Map Viewer
Related Genes BEST:LD04971 CG9596
Original Number 7068
Chromosome 2
Comments FlyBase Insertion: P{GawB}NP7068

NP line. Received from the National Institute of Genetics.

Balancer CyUW14
Cluster id 1072
General Information NP_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Embryonic Expression yalk
Larval GFP weak fb, sg
Larval X-gal fb,
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2020-04-03
Research papers using this strain
[Please submit your publication]
Knight D, Harvey PJ, Iliadi KG, Klose MK, Iliadi N, Dolezelova E, Charlton MP, Zurovec M, Boulianne GL.
Equilibrative nucleoside transporter 2 regulates associative learning and synaptic function in Drosophila.
J. Neurosci. (2010) 30(14) 5047-57 [PubMed ID = 20371825] [RRC reference]

Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np33775_0907
Strand Plus
Insertion Point 6554547
Chromosome Band 2L
Flanking Sequence
anctttggngtgcactcaatttttntgtatacttcggtaagcttcggctatcgacgggac
caccttatgttatttcatcatgGTACAGCTGATACAACGCGGCGATAATCTTGTAGTGCG
GTGCGGTTTTAACCTTTGATTGGATCNAAGAATACATAAGAGAGAACCGGCGCCAAAGAA
CCCATTATNGTTGGGGTCCGTTTTCAGGAAGGGCANNNCATCCGACATGTCATCCTNTTC
AGACCAATCAAATCCATGAAGAGCATCCCTGGGCATAAAATNCAACGGAATTGTGGAGTT
ATCATGATGAGCTGCCGAGTCAATCGATACAGTCAACTGTCTTTGACCTTTGCACTACTC
TCTTCCGATGATGATGTCGCACTTATTCTATGCTGTCTCAATGTTAGAGGCATATCAGCC
TCCACTGAANCCATCTTATTNNNGGCTAAATCGNNNCAGTCACCTGTATTGGCAANNAGN
AGNTGCCTGTGACGTTNAAGNCATCGNGNGAATNCAATGCCCCCCAGGGATTNCNACGNN
TAGGGATCCATGATCNATNNAANNACCNNNNNNNAANAACCCATATTGNNGGNGNCCGNN
NNANGAANGGNNNNCCNTNCNACNTGNNTNCTNTTNNNNCNANNNANNNNTGAANAGCNT
NCNTGGNCNTAAAANNCNACGGNATNGNNGNGNNATATGANNAGCTGCCNNGNNAATNNN
NCANNNAACTGNNTTGNCCTTTGNNNCTACTNTNTTNCNANGANNANGNNNNNCTTATNN
TNTGCTGNNNAANGNNNAGGcnttannctncactgancnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnan

CLOSE