Detailed Information [105467]

Strain Information
DGRC Number 105467
Genotype with FlyBase Link y[*] w[*]; P{w[+mW.hs]=GawB}Sap-r[NP7456] / TM6, P{w[-]=UAS-lacZ.UW23-1}UW23-1
Genotype y* w*; P{w+mW.hs=GawB}Sap-rNP7456 / TM6, P{w-=UAS-lacZ.UW23-1}UW23-1
Break points/Insertion Site 100A7
Map Viewer
Related Genes Sap-r CG31101
Original Number 7456
Chromosome 3
Comments FlyBase Insertion: P{GawB}NP7456

NP line. Received from the National Institute of Genetics.

Balancer TM6UW23-1
Cluster id 1694
General Information NP_lines
Embryonic Expression gut
Larval X-gal sg, gut, mt, tr
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Last update 2015-08-20
Research papers using this strain
[Please submit your publication]
Hindle SJ, Hebbar S, Schwudke D, Elliott CJ, Sweeney ST.
A saposin deficiency model in Drosophila: Lysosomal storage, progressive neurodegeneration and sensory physiological decline.
Neurobiol. Dis. (2017) 98 77-87 [PubMed ID = 27913291] [RRC reference]

Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np40385_0907
Strand Minus
Insertion Point 26703925
Chromosome Band 3R
Flanking Sequence
gtgcactgaatttaagtgtatacttcggtaagcttcggctatcgacgggaccaccttatg
ttatttcatcatgGGAACCACAATAATAGTTTAGTCATAGCTTATTGCGTATTCGTGCTG
TGCACTCTGTTCCTCAACCGTTGCTCTCTTTGTTTGTTTGCTTTCTTGCAGGCGTCTTCG
CCGCTGCCACGCCCCTTTTGGGCTCCAGCAAGTGCACCTGGGGACCCTCCTACTGGTGCG
GAAATTTCAGGTGAGTGCAAAAAAGTGGGTGATACAATAAACGGTATATTCGGATAAATC
GCTTGGTCATCGAACACCACAAAGTTCTCGAAGGCGAAAAGCTAACCTCTCTTAACCCCC
CTCCAAATAGCGATATTACTTCTCCGCCTCACTTGCCCATTGTTTGCAGCGAAGACTCGT
CTGTTCTGTTTTGTTCTCGGCCGATAAGACTATCACTCGAATCGGGAATCGAATCACTTT
GCTCTACATAGCTCTATTCGCCGATAACCCCTGTTATTGCAAACTTAACACTAGTGCCGC
TCTAATTGCGTCCCCTTATTTTGCGTTGTATTGTTTTACAGACTCGATGTTTTCTCTGAG
TGCACTTTTCGCAATACTCTCTGCCTTCATATCCCATATTTCTGGATTTCCTTTGTCTGC
ACATTCGCTGTACAAATCAAATTAACAGTACCGGCAGTCGGAACATTTAGACGGCAGAGT
TAAGCGCTCGTAGGGGGCACAACTTTATCGACACCGATTNTNTGCATGAGTAATCCAGAG
GAGCAGATCGAANATTCATAagagagaaccggcgccaaaaacccattattggtgggggnc
cgttttaggaanggcaagncatncgacatgtnatncttttnanacc

Image Files
Embryo

e1 (->Large)

e2 (->Large)


CLOSE