Strain Information | |
---|---|
DGRC Number | 112043 |
Genotype with FlyBase Link | w[*]; P{w[+mW.hs]=GawB}NP0100 / TM6, P{w[-]=UAS-lacZ.UW23-1}UW23-1 |
Genotype | w*; P{w+mW.hs=GawB}NP0100 / TM6, P{w-=UAS-lacZ.UW23-1}UW23-1 |
Break points/Insertion Site | --- |
Map Viewer | ![]() |
Related Genes | CG40211 CG40225 |
Original Number | 100 |
Chromosome | 3 |
Comments | FlyBase Insertion: P{GawB}NP0100 NP line. Received from the National Institute of Genetics. |
Balancer | TM6UW23-1 |
Cluster id | 2073 |
General Information | NP_lines |
Genus | Drosophila |
Subgenus | Sophophora |
Species Group | melanogaster |
Species Subgroup | melanogaster |
Species | melanogaster |
Embryonic Expression | a small # of cells, oenocyte |
Larval GFP | sg |
Larval X-gal | sg |
Adult GFP | no specific pattern |
Reference | Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S. GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps. Genesis (2002) 34(1-2) 58-61 [RRC reference] |
Last update | 2020-04-03 |
Research papers using this strain [Please submit your publication] |
Hattori D, Aso Y, Swartz KJ, Rubin GM, Abbott LF, Axel R. Representations of Novelty and Familiarity in a Mushroom Body Compartment. Cell (2017) 169(5) 956-969.e17 [PubMed ID = 28502772] [RRC reference] Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S. GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps. Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference] |
Stock Request |
Library & Clone Information |
---|
Library Name / Clone Name | np / np52145_0227 |
Strand | Plus |
Insertion Point | 1527457 |
Chromosome Band | U |
Flanking Sequence | ttttacgtgcactgaatttaagtgtatacttcggtaagcttcggctatcgacgggaccac cttatgttatttcatcatgTGTATAGCCATTAGAGAATATGATGAAGAAGGGACATGTAA GAAgatcgaagaatacataagagagaaccgtcgccaaagaacccattattgttggggtcc gttttcaggaagggcaagccatccgacatgtcatcctcttcagaccaatcaaatccatga agagcatccctgggcataaaatccaacggaattgtggagttatcatgatgnagncttgnc ncgnaggtncaaatncggattaccaagttccnaactgtctttntggcccctttnggtact actcttnttccgatggatgatggccccncttnttctttgctggctcaaggtaggngcatt tannctccctggancatttttntttggggnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnaggnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnngnnnnnngngnnnnnnnnnnnnnnnnnnnnnctnnanaggnnaganananan nganagaganannagnganaganananananagagagaganagagagnganagananann ganganannanntggnnnnanannannagagangnanangannagnaggagnannnggan nnngnnnnnganannntnnnnnnnngnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nngnggnngt |
Image Files | ||
---|---|---|
Disc |
|