Detailed Information [112107]
 

Strain Information
DGRC Number 112107
Genotype with FlyBase Link w[*]; P{w[+mW.hs]=GawB}NP0242 / TM6, P{w[-]=UAS-lacZ.UW23-1}UW23-1
Genotype w*; P{w+mW.hs=GawB}NP0242 / TM6, P{w-=UAS-lacZ.UW23-1}UW23-1
Original Number 242
Chromosome 3
Comments NP line. Received from the National Institute of Genetics.
Balancer TM6UW23-1
General Information NP_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Embryonic Expression sg, a small # of cells
Larval GFP sg
Larval X-gal sg
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2020-04-03
Research papers using this strain
[Please submit your publication]
Shuai Y, Hirokawa A, Ai Y, Zhang M, Li W, Zhong Y.
Dissecting neural pathways for forgetting in Drosophila olfactory aversive memory.
Proc. Natl. Acad. Sci. U.S.A. (2015) 112(48) E6663-72 [PubMed ID = 26627257] [RRC reference]

Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np10035_0727
Flanking Sequence
ACGTGCACTGAATTTAAGTGTATACTTCGGTAAGCTTCGGCTATCGACGGGACCACCTTA
TGTTATTTCATCATGGATCGAAGAATACATAAGAGAGAACCGTCGCCAAAGAACCCATTA
TTGTTGGGGTCCGTTTTCAGGAAGGGCAAGCCATCCGACATGTCATCCTCTTCAGACCAA
TCAAATCCATGAAGAGCATCCCTGGGCATAAAATCCAACGGAATTGTGGAGTTATCATGA
TGAGCTGCCGAGTCAATCGATACAGTCAACTGTCTTTGACCTTTGTTACTACTCTCTTCC
GATGATGATGTCGCACTTATTCTATGCTGTCTCAATGTTAGAGGCATATCAGTCTCCACT
GAAGCCATCTTTTTTTTGGGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnn

Library Name / Clone Name np / np56013_0309
Flanking Sequence
GTNTNTGGGGAAAAAAANCCANGTTTGGGGAAGGGGAANACCCTTGNCGACGGGNACCCC
TTATGTTATTNGATCATGACTCGATCNNAGNGCGGGAGAATAGGGCAATNGTGGAGATGG
AAAATAAANCTAGAAANATGAGNACGNNAAAATAATANGAAGAGGAAAGGAAAAACANAC
GGACATGANATANGGANAAGAGACAANNAAAAACTCNTGCTTTTTTTTNTAAGGGNAGGN
AAATAAGGNNGGGGGGGGGGCCCGAGCAAANGACCNNAAGGAGAGNANNNGNAGAANGAN
GNNGGNGNACTNNANANCAANAGAAANAAGNANNGGGANGNGGAGGNAGCNNTGGAGNGN
AGGNGGGGGNANNAAAGACGAGAAANGGNGGGGGGNGAGANANNGGTNGAGGGAGNAGAA
ATNGNGNANNCNGGTGNATNNNGNGNNGGNNCCAAAANAGAAGNGNGCNGGGGGGGGGGG
TGGGAGAANNGGGGGNGGGGGGGNGGGGGNANAAATTTGNNGGGGGGGGNGGGNNNANAN
AAAANACCCCCAANAAAANTNAATAGGGGGGNNGGAGAGGAAAGGNAAAAGAAANAGCCC
CCNNGNNNAAGGGNNGNCNGAANCCGCGCGGGGNGGCNGGGANANNAANNGNNGGGGNNN
CCGNGAAGNAGNNGANNNGTGGNAAAAAAAACGAGNNNGNAAGGGGGGAAANAAAGAGGN
AGAGANNNGGANACANTANTANGNAANNAANAAGANAGAANNGNGNNNGACAAAAAANAA
TCTGAAAGGNNNNGNATNAAaaaaagcgaaagcnaacacaaaangnatnnnaagaaagaa
aannggatggaagnnaagaacnnggaagnacgtnggtaannngaaaaggtnggcngaaca
aaaacannngnggggannnnagnaaaanaaaannaaagagcaaaaagnnagtggnngtcn
aagccagcacgnnancnnangnaaangncaatnananananangananaangggntnaag
tgagangnngannaaganaaaaaaaaaan

CLOSE