Detailed Information [112149]
 

Strain Information
DGRC Number 112149
Genotype with FlyBase Link w[*]; P{w[+mW.hs]=GawB}Gadd45[NP0351] / CyO, P{w[-]=UAS-lacZ.UW14}UW14
Genotype w*; P{w+mW.hs=GawB}Gadd45NP0351 / CyO, P{w-=UAS-lacZ.UW14}UW14
Break points/Insertion Site 43A2
Map Viewer
Related Genes CG11086 Ady43A
Original Number 351
Chromosome 2
Comments FlyBase Insertion: P{GawB}NP0351

NP line. Received from the National Institute of Genetics.

Balancer CyUW14
Cluster id 555
General Information NP_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Embryonic Expression muscle subset
Larval GFP fb
Larval X-gal sg
Adult GFP abdomen
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Bgatova N, Dubatolova T, Omelyanchuk L, Plyusnina E, Shaposhnikov M, Moskalev A.
Gadd45 expression correlates with age dependent neurodegeneration in Drosophila melanogaster.
Biogerontology (2015) 16(1) 53-61 [PubMed ID = 25252831] [RRC reference]

Moskalev A, Plyusnina E, Shaposhnikov M, Shilova L, Kazachenok A, Zhavoronkov A.
The role of D-GADD45 in oxidative, thermal and genotoxic stress resistance.
Cell Cycle (2012) 11(22) 4222-41 [PubMed ID = 23095639] [RRC reference]

Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np39215_0907
Strand Minus
Insertion Point 2309990
Chromosome Band 2R
Flanking Sequence
ctnnttnggggaaanaaccccttttgggggcnnncggnaagccccggctatcgacgggac
caccttatgttatttcatcatgTGCGAGAGCGAGAGCTTTTTAGGGGGGCTCGCTCTCCC
GCTCTTGCGCTCTTTCAGCCAAATCGGGTTTTTTCATTACTTTTTTTGGGATCGAAGAAT
ACATAAGAGAGAACCGNCGCCAAAGAACCCATTATTGTTGGGGGTCCGTTTTCAGGAAGG
GCAAGCCATCCGACATGTCATCCTCTTCAGACCAATCAAATCCATGAAGAGCATCCCTGG
GCATAAAATCCAACGGAATTGTGGAGTTATCATGATGAGCTGCCGAGTCAATCGATACAG
TCAACTGNCTTTGACCTTTGTTACTACTCTCTTCCGATGATGATGTCGCACTTATTCTAT
GCTGTCTCAATGTTAGAGGCATATCAGNCTCCACTGAAGCCATCTTATTTTGGACTACTN
NCTTCCGATGANCATGACCCNCTTATTNGANCCTGANTCCNTGGTNGAGGCATGTCAAGN
CNCCACTGNAACCAATGNTNTCTGNNNNNNNACCAACGCNANNTNNGCNCANNTNNNNTN
TNCTTNGNCGNNTNGANNAACNNNNGNCCTTNCTTACCCAANNNAACCCNNATTTTATTT
NTGGNCCNGGNTTNNCNCGNNNNNNNNNNNNNNNNNNNNNNNNNCCNNNNNNNNNNNNAN
CCCNNNNTTGNNNGGGNNNCNNNNNNNNNGGNNNGGNNNNNNCNNNNNNNNNNNNNNNNN
NNNNNNNNNCNNNNNNNNNNnnnnnnnnnnnnnnccnnnnnntnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnccnnnnnnnnnnnnnnnnnnnnnnnnntnnnnnnnnnc
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnann

Image Files
Disc

d1 (->Large)

CLOSE