Detailed Information [113037]
 

Strain Information
DGRC Number 113037
Genotype with FlyBase Link w[*]; P{w[+mW.hs]=GawB}sli[NP2755] / CyO
Genotype w*; P{w+mW.hs=GawB}sliNP2755 / CyO
Break points/Insertion Site 52D1; -; 52D2
Map Viewer
Related Genes CG8291 sli
Original Number 2755
Chromosome 2
Comments FlyBase Insertion: P{GawB}NP2755

NP line. Received from the National Institute of Genetics.

Balancer CyO
Cluster id 791
General Information NP_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Embryonic Expression cns
Larval GFP cns (small subset)
Larval X-gal sg
Adult GFP internal
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2020-04-03
Research papers using this strain
[Please submit your publication]
Hartman TR, Ventresca EM, Hopkins A, Zinshteyn D, Singh T, O'Brien JA, Neubert BC, Hartman MG, Schofield HK, Stavrides KP, Talbot DE, Riggs DJ, Pritchard C, O'Reilly AM.
Novel tools for genetic manipulation of follicle stem cells in the Drosophila ovary reveal an integrin-dependent transition from quiescence to proliferation.
Genetics (2015) 199(4) 935-57 [PubMed ID = 25680813] [RRC reference]

Shuai Y, Hirokawa A, Ai Y, Zhang M, Li W, Zhong Y.
Dissecting neural pathways for forgetting in Drosophila olfactory aversive memory.
Proc Natl Acad Sci U S A (2015) 112(48) E6663-72 [PubMed ID = 26627257] [RRC reference]

Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np24825_0807
Strand Plus
Insertion Point 10985216
Chromosome Band 2R
Flanking Sequence
ctntttgggggaaaaagcccntttttntntactncggtaagctctcggctatcgacggga
ccaccttntgttatttcatcatgGGCGGGACATAAAAATGCTAATACAAAACACTAGAGC
AAATTGCGGCAAAATAAGTTGTGAGTGGCGGCGGTGGAGGTGTCTGAGTGGCGAGCGAAC
TTGGCACCAGCTAACTAACTTTGCACGCAGGATTATCGCANGGTNNCTTACCGTTTTAAT
CAGGCGAAAACACCGCTAATCCAATCGTAATCGTAACACCCACACAGACAAAGAAACAAA
ACACTAACACAACAAAGACACTAATTTTCGGCACTTTGCAGACGGAATTTAAATTCGACT
TTTGCGCTTTTCTGCTGCTGCGATTTGTGCTTCAATTCGATTCGATGCGATTCGCGCAGA
CAAACGAAATTCAGGAATTTCAAGTGGAAATCTCGTTTGAGCACTTTTCGACCTGCGACT
TACGAAGACGGCGCGGCAGAAAACTTTGGCCTTAACTTGGCTTTAAAATGGCCGTGCAAA
TGTGGATTGGCTNAGAACGCGCGACTTCAATTGGCAAATGCACACTTTATGGGTTTTGCT
TAAGTTTGGCAATTGCAAATTCTTTTGCTCACCGGAATCTTCACTCTTGGGTTATACTAT
AATTCTTTTTGGACGCCTCTACNCGACCCCGATTGAAAGTGATGCGTGCGTNTGACTGGT
NTCGTCGCCGTTCGAATTTTTATGTTTTTGTTTCNCTGCCGNGCAGNGTTNCCAGATGCA
GGAGTNANCCTCCCCGGCAGaanggcctaaaaaaaccgggttccccaacagtttaaaagn
ttttggtccaccttaaattcnaaaattttnggttannaaggggccnaaacctcgttcatt
tttaagggntggttaattttttttgnaaatttttttttttaaancttttaaccttntncc
caaattntaagagggtggnccccccnn

CLOSE