Detailed Information [113060]
 

Strain Information
DGRC Number 113060
Genotype with FlyBase Link y[*] w[*] P{w[+mW.hs]=GawB}Clic[NP3012] / FM7c
Genotype y* w* P{w+mW.hs=GawB}ClicNP3012 / FM7c
Break points/Insertion Site 12C2
Map Viewer
Related Genes CG10997 BcDNA:LD21129 CG11095
Original Number 3012
Chromosome 1
Comments FlyBase Insertion: P{GawB}NP3012

NP line. Received from the National Institute of Genetics.

Balancer FM7c
Cluster id 333
General Information NP_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Embryonic Expression weak
Larval GFP sg, gut
Larval X-gal oenocyte, gut
Adult GFP mouth, oceli, abd
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Nakagawa Y, Fujiwara-Fukuta S, Yorimitsu T, Tanaka S, Minami R, Shimooka L, Nakagoshi H.
Spatial and temporal requirement of defective proventriculus activity during Drosophila midgut development.
Mech. Dev. (2011) 128(5-6) 258-67 [PubMed ID = 21376808] [RRC reference]

Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np33605_0907
Strand Minus
Insertion Point 13552973
Chromosome Band X
Flanking Sequence
gnnnngnnnggngggnnnngnnnaagggnnngnnnngnnangtttttggnnnggntntct
tgggggnganannccatttttttgngtacttncggtaagncttcggctatcgacgggnac
cacctttatgttatttcatcatgGGCTAACCAATTCAATCGTGAATAGACTTTAGCAGCG
CGCAAATCGTAGAACAGAACGGCATATTTTTTTTAAACACTGCGAGGCGAGCTTCTTCTT
CCCTCCGTCTCTCTGTGTGTGTGTGAGTGTGCTGCCTGTGTGTGTTACAGCTTGTGTACG
TGAGTGTGTGTATTGGCAAAGGAAATTAGCACAACAAAAGCGAAAAGGAAACGAACACGC
ACGCACCTCGTCACGCGGATAAAGAAAAAAACTCTTCGATCTGATCAGANATATCNANAA
TNNNCGATAAAAANANTAACAATATCGNAGTGTCGGAAGTNGAATCGNANCANANCCAGG
ANACGAACGGNANCANTAAATTCNANGTGCCCGAGATNGAATCGANCGAATAATACATAA
CGAGAGAACCGNNGCCAANGAACCCANNATGTGGTGGGGNCCGATTCAAGGAAGGGCAAG
CCATCCGACATGNNANNCTCTTCAGACCAANNAAATCCANGAAGAGCATCCCTGGGCATA
AAATCCANNGGNATNGTGGAGCAATGANGACAGCCTTNNCGGGNNCAAATCGATACAGNC
AACTGTCTTTGACCCTTTGGTACTACTCTCTTCCGATGATGATGTCGCACTTATTCTATG
CTGTCTCAAATGNTAGAGGCatatcagtctccactgagcatnnnnnnnnnnngggnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn

CLOSE