Detailed Information [113112]

Strain Information
DGRC Number 113112
Genotype with FlyBase Link y[*] w[*] P{w[+mW.hs]=GawB}Act5C[NP3121] / FM7c
Genotype y* w* P{w+mW.hs=GawB}Act5CNP3121 / FM7c
Break points/Insertion Site 5C7
Map Viewer
Related Genes Act5C pogo{}66
Original Number 3121
Chromosome 1
Comments FlyBase Insertion: P{GawB}NP3121

NP line. Received from the National Institute of Genetics.

Balancer FM7c
Cluster id 159
General Information NP_lines
Embryonic Expression ubiquitous epi.
Larval GFP ubiquitous
Larval X-gal ubiquitous disc, fb, gut, mt
Adult GFP ubiquitous
Genus Drosophila
Subgenus Sophophora
Species Group melanooaster
Species Subgroup melanogaster
Species melanogaster
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Debat V, Bloyer S, Faradji F, Gidaszewski N, Navarro N, Orozco-Terwengel P, Ribeiro V, Schlotterer C, Deutsch JS, Peronnet F.
Developmental stability: a major role for cyclin G in drosophila melanogaster.
PLoS Genet. (2011) 7(10) e1002314 [PubMed ID = 21998598] [RRC reference]

Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np35115_0907
Strand Plus
Insertion Point 5642065
Chromosome Band X
Flanking Sequence
ttancgtgcactggaatttaagtgtatacttcggtaagcttcggctatcgacgggaccac
cttatgttatttcatcatgCTTGGAGCATTCGTTCATGTACACACACTCACGCGCAAAAT
AACGAGAGAGAGTGTATGTGTGTGTGAGAGAGCGAAAGCCAGACGACGGTTTGCTTTTCG
CCTCGAAACATGACCATATATGGTCACAAAACTTGGCCGCCGCAATTCAACACACCAGCG
CTCTCCTTTCGCACCCATAGCGACCATGGCGCGGGAGCGAGCGAGATGGCGAGAGCGAGC
GACGCCTATGGGCGACGTCGACGCAGGCNGGCGATTGAAAAACGCAGTTAACTGGCATTC
AACATTCACCAGCCACTTTCAGGTCGGNTTATTNCAGTCATTCCTTTCAAACCGGGCGGN
CGNTTAACTNAACCTTGCCACTTGNGTTTACNGNAGNTTTCANGCCTTGGATTTGGTAAA
TNCGAACCAAAAGGNAAAGNTTAACTAGCTTTGAAAAGGTTCGNGGNTTTTAATTGGTAA
ATTTTCTNGAGGGNGGTTANGGGTTTTTTTTTTTTTTTGGGAAGGGNAATTNNGGGGNCC
AAATCGGGTTTTAGGGCNCCCCCTTTTTANGGGNCCCACCNCCCAGGGAAANNGGGTNNT
TTTGGGGGNTTTTTTTTGNCCCGGNTTTNNNNAAAGGGGGNNNNAAAAAACTTTCCCCCC
CCTTTTTGGGGAATTTGGNNNGGGGGGGTTNAATTTTTNGGGGGGGGGGCCCTTTNTTTT
GGGAACGGGGTTTTTTAATTtttttntacaaannnnnnnnnnaaaaaaaaaaaannnnaa
cccnnnnnnaaaaaacccnnttttngggggggnccccntnnnanagaang


CLOSE