Detailed Information [113113]
 

Strain Information
DGRC Number 113113
Genotype with FlyBase Link y[*] w[*] P{w[+mW.hs]=GawB}NP3123 / FM7c
Genotype y* w* P{w+mW.hs=GawB}NP3123 / FM7c
Break points/Insertion Site 11B1
Map Viewer
Related Genes CG11138 LIMK1
Original Number 3123
Chromosome 1
Comments FlyBase Insertion: P{GawB}NP3123

NP line. Received from the National Institute of Genetics.

Balancer FM7c
Cluster id 305
General Information NP_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Embryonic Expression mesodermal
Larval GFP ubiquitous
Larval X-gal sg, tr
Adult GFP internal
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Nakagawa Y, Fujiwara-Fukuta S, Yorimitsu T, Tanaka S, Minami R, Shimooka L, Nakagoshi H.
Spatial and temporal requirement of defective proventriculus activity during Drosophila midgut development.
Mech. Dev. (2011) 128(5-6) 258-67 [PubMed ID = 21376808] [RRC reference]

Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np35125_0907
Strand Plus
Insertion Point 12313844
Chromosome Band X
Flanking Sequence
ttgcgtgcactgantttaagtgtatacttcggtaagcttcggctatcgacgggaccacct
tatgttatttcatcatgGAGTGTGGCCTTGGCTGGTATGTGAGAATATACCCCAGGGGCC
AAGCGAAATGTACTAAAAAATCTTCGCTGCCGCAATGGGAAATACCAAGAAAATACCTGA
AATACTGGCTTATATCAGAGACACGAACCTTTCAGTGGACTTCAACCAGGGTTGCCAAAG
TGGCTGAGACTGTAGCGAAGACTTCAACCATGATAAAGCTAAGGAAATTTTAAATTTTCT
TTAAAATTTAGCATCATTTTGAGCATAGTAATTCTACTATTTCGTATTAATATATATAGC
TTTTAATATATTGGCTCCTAATATTACGCCCAAATATTAAAAATAAACCCTTTTGGCTGN
TTAAGTAATTAAAAATAATATTTATTTTTATTTTTAACCCCCTTTGGGGCTACGACCCTG
CCAGCGGACGTGCCTGCACGTCATATTCACGAAACGGGATCTAGTGACGAAGTCCTTTCC
CCCAAGTCCGGCTGGTAGTATACCATGTAAAGGTCGNGGGAACNCATCCGGTTTTCGTAT
AGATACCCGAACGTTTGGTCATAGGATACAGGTATGTAGACCCTGGATCTGGGATGCCTC
GTCTTTTTCGGTTGGGGAACAGGCTGACTTNACAGAGCTTTGGTACTGGTNATGGAAATN
AAAGGCCCNANTTCTTGGCAAAAAAAAAAAAAAAANANGGGCCTTCCTNAAAGNCNTGGG
GAGGANCCAAAAANGAAAACctnntttggntnnccccaannnggggnntttttgccccat
tttttnggggcaaaaaggcttggggggttnnnatttccccgggggnttggncccaan

CLOSE