Detailed Information [113192]
 

Strain Information
DGRC Number 113192
Genotype with FlyBase Link w[*]; P{w[+mW.hs]=GawB}Vha16[NP3270] / CyO, P{w[-]=UAS-lacZ.UW14}UW14
Genotype w*; P{w+mW.hs=GawB}Vha16NP3270 / CyO, P{w-=UAS-lacZ.UW14}UW14
Break points/Insertion Site 42C1
Map Viewer
Related Genes Trap1 Vha16 invader1{}757
Original Number 3270
Chromosome 2
Comments FlyBase Insertion: P{GawB}NP3270

NP line. Received from the National Institute of Genetics.

Balancer CyUW14
Cluster id 536
General Information NP_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Lethality lethal
Embryonic Expression scattered cells (SG)
Larval GFP gut, mt, anal pad, sg.
Larval X-gal mt, gut, oenocyte
Adult GFP ant, head body wall
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Nakagawa Y, Fujiwara-Fukuta S, Yorimitsu T, Tanaka S, Minami R, Shimooka L, Nakagoshi H.
Spatial and temporal requirement of defective proventriculus activity during Drosophila midgut development.
Mech. Dev. (2011) 128(5-6) 258-67 [PubMed ID = 21376808] [RRC reference]

Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np16625_0727
Strand Plus
Insertion Point 1693425
Chromosome Band 2R
Flanking Sequence
gtttttttnnngnatnttnttgggtgacaangcctttttttgnntacttncggtaagcct
tcggctatcgacgggaccactttatgttatttcatcatgGTGTGGAGTGTGACCTGTGTG
CATGTGCATGTTGTCATGTGCTTGTGTGCGCGCGAGAGTGAGCGCATGACAGGCACACAT
CACGGATAGTAAGTCCAATTGGCAATGACAACGGTCTGGAAAATTACACNTNTACACACA
ATCACATGGGAGCTGTTAAAACCCTGGTTTCCAGGCTTTTGCAAAATGAAAATGCAATTT
TTGCACTTTCTGAAGATGCCTGTGCTCCTTGTTCAATTCCCATTGCTCAACGCGCAAAAC
TCACACTCACAAGGAATCTCATTGTCATTGGCTAAGTGTGGCTTGCCTGTGTGTGTGCAT
GTCGTGGCAGAAAATATTGTACAATTTTTTTTCTGTTTGAACTCTGTTCAAATTCAAGTT
GTCGCAGCAGCATGTTTTATCGCAGGCCCGAAACTTTTCCGCAGGGCTAGCCTCACATGA
CCGCCTATCTTTTGACTGCTTTTTCACTCACGTGATTAGAAATCTAATTAAAAGCAATTC
GCTGCTCTGTGGCCTCTTCGGGTTACTGCTGGCTGCTGCTTAAAAGCGCGgatcgaagaa
tacataagagagaaccgncgccaaagaacccattattggtnggggtccgttttcaggaan
ggcaagccatncnacatgtnatnctntttagaccaatcaaatccatgaagagcatncctg
ggcataaaatccaacggaattggggggntatcatgatgagctgccgagtcaatcgataca
gncaactggctttgacctttggtactactctcttccgaggatgatgncccacttattcta
tgctggctcaatggtagaggcatatc

CLOSE