Detailed Information [113956]
 

Strain Information
DGRC Number 113956
Genotype with FlyBase Link y[*] w[*]; P{w[+mW.hs]=GawB}NP6510 / TM6, P{w[-]=UAS-lacZ.UW23-1}UW23-1
Genotype y* w*; P{w+mW.hs=GawB}NP6510 / TM6, P{w-=UAS-lacZ.UW23-1}UW23-1
Break points/Insertion Site 73E5
Map Viewer
Related Genes CG7725 TpnC73F
Original Number 6510
Chromosome 3
Comments FlyBase Insertion: P{GawB}NP6510

NP line. Received from the National Institute of Genetics.

Balancer TM6UW23-1
Cluster id 1949
General Information NP_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Embryonic Expression sg. weak ubiquitous.
Larval GFP gut
Larval X-gal sg, gut, mt, weak epi
Adult GFP internal
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2020-04-03
Research papers using this strain
[Please submit your publication]
Cheng X, Jiang H, Li W, Lv H, Gong Z, Liu L.
Ten-a affects the fusion of central complex primordia in Drosophila.
PLoS ONE (2013) 8(2) e57129 [PubMed ID = 23437330] [RRC reference]

Donlea JM, Thimgan MS, Suzuki Y, Gottschalk L, Shaw PJ.
Inducing sleep by remote control facilitates memory consolidation in Drosophila.
Science (2011) 332(6037) 1571-6 [PubMed ID = 21700877] [RRC reference]

Guo C, Du Y, Yuan D, Li M, Gong H, Gong Z, Liu L.
A conditioned visual orientation requires the ellipsoid body in Drosophila.
Learn. Mem. (2014) 22(1) 56-63 [PubMed ID = 25512578] [RRC reference]

Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np46095_0912
Flanking Sequence
AGGGAAAGGGGANAAAAAAAAAAAAAACAGGACTANAAAAAAAAAAACCCCGAAGGGGGG
GGGCCNCACCCCCACAAGATNTCGCGAGANAANNCAGAGGGACNNCCGGGGNAANCAACG
NANGAGAGGACCANCAACCGANGGAGGACGACGNCANNAGAGGGGGCCCCAANGNCCGAN
GAAGNACAAGAAANANGNACNGACGACNGAAAACGCCGGGNGNGGAGAAAAGAANAACCA
AANAAAGGAGAGNANNCAAAAANNCCGCNCGGCCGGCNGNGNCNAGCAACNANAANNNNC
AAAANCAAAAAGAAACNAAAACCNAGGGANAAGGGAGNANNAANAAAAAGACAAAGAGGN
ACCCAACANAGNCCCGCCGNCCAAAAANGCACCGNNCAGGNAGGNGCNCAGNAAAAAAGA
AAGANNGCAACAAAACAAAACGAGGNANAAACAAAGNNAGGNNAANGNCCCNNAACNCAA
AAANCAAATAANANAAAAACAANGAGAGAANAAAACCACNAAAAAAAAAAAACAGCANCA
CGGCNCCCNGNNCNACGGANNNNAAACCNANCNAAGAACCAAAANAATAACAANGAAGTG
ANAGAGANCAGAAAAAANCCCCANAATNGNNANCNANCNNCNAGGAAATAAANACACNAG
AGGANNAAGAANCACACAAACANNGANAAGNAAANAANNGAAAAANAACGNANAACAANC
GAAANANACAACAGNAGNCCANCANNNNNGACNNNNCCAAAAACAACCANGAAACCNCAA
ANCAAAANANNAANNAAAAGagcnannnangnaggnagnaaaaaaaancccnnnaanana
anaaggcaacncnnacagaaaaaanaccnaaaancnanaancaacaaaaaacaaanaaac
aaagancacaaaancganaangnnacacanaacaacnnaacagaagagaacanccacgaa
cgaaaccncaaaaagaaanccgacaaaaaaanaaccgcacacgnagnccnnggcnctnca
nccngacnacnaatacnaacaanacaanccggtgcnaccggnacacacagnnncaaanaa
cgaaaacaagccngcanacgnacaanacnccnacaaanacncacnaaaaaanccccccnn
ccaaacacggnacgannacaacacgaacaanaagagngaaagaaaaaagacgaaagagca
gaaacnaagnanaancaagaanagaacacaacgaagaaagaaggagaannnagaacanga
ngannannngataacaaatancanacnngacaagaacaaagaccaccgcagaaacaccnc
cnngccaanacaanaccccnacngacaacacaagaancacgaccaanaacaccagaaaaa
ncgaanaacacggacaaaaanaaaagcaaaacccacaacngagaagatnanangacaaca
nnatgcngcaccnacaagaaaaaacgnanaaacancgnncagaaaanaanaacacnccna
ncnnancaaanannacganagaaccnanacncgacaaagancccaaccnnacaagaaaat

Library Name / Clone Name np / np66343_0309
Strand Minus
Insertion Point 16998515
Chromosome Band 3L
Flanking Sequence
GNNNGGNGNGNNNGNNTGGGGGNGGGNTNGTTTGTTTNTTGGGNNANTCACCGNGGGTNT
NNANNCCCGTNNTNTTGGGGGNGGNNGACACCTGCCGACGGGNACCACCTTATGTTNTTT
TATCATGTAGCATACCATCCAAATGACGAGGCCAATGCTCGTTGTAGTTAACGTTAACGT
GGTTAAGACGGAGCTTTCGGCCAGGCAGCTTTCTTTGGCCGGATCCTCTAGCTAGAGCTT
NGGCCACTAGTGGATCTGGATNNTTTAGCTANNNTTTTGNNNNNNNNNNNNTTTNNGGGG
GGGGGGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGGGNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
ncccccccccccc

CLOSE