Detailed Information [114023]
 

Strain Information
DGRC Number 114023
Genotype with FlyBase Link y[*] w[*]; P{w[+mW.hs]=GawB}NP6658 / TM6, P{w[-]=UAS-lacZ.UW23-1}UW23-1
Genotype y* w*; P{w+mW.hs=GawB}NP6658 / TM6, P{w-=UAS-lacZ.UW23-1}UW23-1
Break points/Insertion Site 79E3
Map Viewer
Related Genes CG14460 CG32450 Ten-m
Original Number 6658
Chromosome 3
Comments FlyBase Insertion: P{GawB}NP6658

NP line. Received from the National Institute of Genetics.

Balancer TM6UW23-1
Cluster id 2034
General Information NP_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Embryonic Expression mesoderm strong in heart.
Larval GFP weak tr and fb (late)
Larval X-gal peripodeal memb? of the wing disc, CNS, fb, ch
Adult GFP internal abd
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2020-04-03
Research papers using this strain
[Please submit your publication]
Hattori Y, Usui T, Satoh D, Moriyama S, Shimono K, Itoh T, Shirahige K, Uemura T.
Sensory-neuron subtype-specific transcriptional programs controlling dendrite morphogenesis: genome-wide analysis of Abrupt and Knot/Collier.
Dev. Cell (2013) 27(5) 530-44 [PubMed ID = 24290980] [RRC reference]

Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np01525_0711
Strand Minus
Insertion Point 22325673
Chromosome Band 3L
Flanking Sequence
ttttttnnnnnnanncctnggggaaaaaacccccntntttgggggacnnaaaaaanccct
cggctatcgacgggaccaccttatgttatttcatcatgCCCTTAGCCAAACGAAACGCAC
TTTTTAACCTTCAAACCAGAGATTCGATGAGTGCTCTCATTTGAGTGCTGCATACTCTTC
TGGTTATAAAAAGGCTAAACATACCATTGAGAACAAATATTGATGGTAACTTTTTTTTAA
GCACAAGAGTATTAAAAGTATATTATTATATGTCCTTGCATATCTTTTTCTATAACGCTG
TCATACACTGGAAATCGATATGATTCGGAGTGATTCTTTTGCAATTAAATTAACCTAAAC
TACAAAAGTAGCATCTATTATTCTAGCAAAATAGCTATATTTCCAGCTAAGGCCAGACTA
TCAGAAAATTAGCTAAATGGACAACGCTGGTGCGCGACCGCTCTCTCTCTCTCAAATCAT
GCGCAGTATCAGAATAAATGAGAGCGATACATTTTAACTGAAAAAGAGAGAATATGAAGC
ATATTGTTTTTCTCTCATATTTGCAGCGACTTGCGCTCTCTAGCTCTCTCTCTCTCTCCC
ACAGACTCGGTTCGTCGNTCGTTTNGAGCTCATTCGTCTTTNGAAATTCGCCTCGCACGG
NCGGAATTTGTCGTCGCGGAAAATGGGGGATATACNAAAAAGTAGCGAAAACAGCGCGNN
GCTTCAGNCGAAAAATATAGGAAATCGNCGGGAATCAGGCNGCGAATGATCCCTGNGTTT
AACAAAATTCTGACATAGTTtaccgatccgagaaancataagaaaaaaancggcgncaaa
aaacccatnnttggngggggcccgttttcaggagggggnagccntnccgnnntgtnttnc
tctttaagaccaatnaatncctnganggcatccctgggc

Image Files
Embryo

e1 (->Large)

e2 (->Large)

CLOSE