Detailed Information [114122]
 

Strain Information
DGRC Number 114122
Genotype with FlyBase Link y[*] w[*] P{w[+mW.hs]=GawB}amn[NP7177] / FM7c
Genotype y* w* P{w+mW.hs=GawB}amnNP7177 / FM7c
Break points/Insertion Site 18F4; -; 19A2; ---
Map Viewer
Related Genes amn CG15618 CG32529 CG40160 CG40162
Original Number 7177
Chromosome 1
Comments FlyBase Insertion: P{GawB}NP7177

NP line. Received from the National Institute of Genetics.

Balancer FM7c
Cluster id 472 2098
General Information NP_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Embryonic Expression sg
Larval X-gal sg
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2020-04-03
Research papers using this strain
[Please submit your publication]
Shuai Y, Hirokawa A, Ai Y, Zhang M, Li W, Zhong Y.
Dissecting neural pathways for forgetting in Drosophila olfactory aversive memory.
Proc. Natl. Acad. Sci. U.S.A. (2015) 112(48) E6663-72 [PubMed ID = 26627257] [RRC reference]

Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np06285_0711
Strand Minus
Insertion Point 2920156
Chromosome Band U
Flanking Sequence
gttttttttgnnngggattanctgtnngngacanaaacccnntncntnggnnacttncgg
taaagacncccggctatcgacgggnaccaccttttgttatttcatcatgGCCCAAACCGA
GTCCGAGCAGCAGCAAAACGCTGGCCCACAGCACTATGGGGCATTTGGCCTGTTTTTTTT
ACAAAAATTAATACCTCCTAAACTATTGGAGATATTTGGATGAATTTTTTTTTATGCNTT
ACACATGCNTNCAGGAATATTTTGGAAAAGNGGGNGNGCCCCAACTCCGCCCCATTTTTT
TTTTTTTTTTTTTTTTTTAAAAAAAAAANNTTAAAAAANTTTTTTTTAAATNNAAAAAGG
GNAAAAAAAAAANCNNNTTNNNTTTTAAAAAANNGGGGGGGGNNAAAANTTTTTNANGGG
GAAAAATCNNGGNNNNAANTTTNAAAANNTTTNGGGGGNAAAAAAAANCCCNNNNTTTTC
CCCCCNTTTAAAANTNTNGGGGAAATTNGGGGGGGNAAAAAAANNAAANAAAANNCCCCC
CCAAAAAAANCCCNNTTTNGGGGGGNCCCCNTTNNNNGNGGGGNNNCCCCCCCNCNTNNT
CCCNTTTNAANAAAAAAAAAAAAAAAAANAAANNCCCCGGGGAAAAAANACCAANNNAAN
GGGGGGAANAAAAAAAGNGGGNNNNNGAAAAAAAAAAAAAAAAAAAGGGNNNNNCCCTTN
AAAACNCCNTTTNNCGNGNAAAGGGGGNCCCCCNNNTTTTTGCNGGNCNAAGGGGGGGNG
GGAAAANANNCCCCCNAGACcnnnnnnnnnnnggggnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnannnnnnnnnnnnnnnnncnnagannn
nnngnnngnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnncnnnnnnnnnn
nnnnnnancn

Library Name / Clone Name np / np55193_0309
Strand Minus
Insertion Point 19618087
Chromosome Band X
Flanking Sequence
ctttactncgcacttattgcaagcatacgttaagtggatgtctcttgccgacgggaccac
cttatgttatttcatcatgGTTTGGGCCAACACTTGTCGCCTCTTGGCCATTATGCAACG
ACAGCGAAACGAAGGTGCTCACGAAGNGGCCAAGCTGNTCTCTGATNGGTCGGNGGTCAG
TGCCACGAGGCCAGCCGAAGTTCTCTCGCGAGAACCCAAGAGCACTCTCTCCCTCTCTTT
TGGGAGAGATGAGATAGCAAAGAAAAGCCAAAACACTAGAACAATCCAGAAGCCAAGTTT
TCCGGCTTGCACATACGCCGTATAATCCGCATTTTTTGCGAACTCTAAACTCGAGTCTAT
CAGCTATAATATTACAATTCGTTCACTATAAACAAATAAACTAATATAGTTTTGCTCAGA
AATCGATGCACTATGATGAGAGAATAGTGAAAAACAATTCTCAGTTAATAGCTTTTAAAC
TGCGCTGCAAATGGGAAAACAAATTAAAATATACACATTTTCATGCCAAATAATAGGATA
TCCTATCCTTCATTATATAAGCATAAACAATAAAAATATTCTAGCTCGCTTTGATCCTCT
AGCNGANNCTTTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn

CLOSE