Detailed Information [200633]

Strain Information
DGRC Number 200633
Genotype with FlyBase Link y[*] w[*]; P{w[+mC]=GSV2}GS5005 / SM1
Genotype y* w*; P{w+mC=GSV2}GS5005 / SM1
Break points/Insertion Site 32D3
Map Viewer
Related Genes CG6181(CT19382)
Received Date 1/28/03
Original Number 5005
Comments Sb Ser, TM3 floating. 26Apr2017 E.O.
Received from Tokyo Metropolitan University.
Original Comments Vector: GSV2
Location (tagged genes): Intron
Function / Process (tagged genes): structural protein
General Information GS_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanooaster
Species Subgroup melanogaster
Species melanogaster
Reference Toba G, Ohsako T, Miyata N, Ohtsuka T, Seong KH, Aigaki T.
The gene search system. A method for efficient detection and rapid molecular identification of genes in Drosophila melanogaster.
Genetics (1999) 151(2) 725-37 [RRC reference]
Last update 2017-11-21
Research papers using this strain
[Please submit your publication]
Fan SJ, Marchand V, Ephrussi A.
Drosophila Ge-1 promotes P body formation and oskar mRNA localization.
PLoS ONE (2011) 6(5) e20612 [PubMed ID = 21655181] [RRC reference]

Toba G, Ohsako T, Miyata N, Ohtsuka T, Seong KH, Aigaki T.
The gene search system. A method for efficient detection and rapid molecular identification of genes in Drosophila melanogaster.
Genetics (1999) 151(2) 725-37 [PubMed ID = 9927464] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name GSV2
Insertion Point 11100587 (based on Drosophila melanogaster genome annotation release 4.1.1 date 20050421)
Flanking Sequence
ACGCACATGACTTCTATTTCCTGGGGCTCTGCCGCATTGCCGTTGGCGGCAATCGGCTTG
TCCTGTTCGGCGCTGTTGCTCATCCCGGATGCTGCGTCAATGGCTGAAGCAGTAATGCTG
ATGCAGGCGTCTGCTGGCGGTGGATGGTACGCGGTACTTGCTTTGCCACACCTTGGCGAC
CGGTGGACAGACGGCGGCGGGGAGGAGGAGGCTGACAAAGGCGTCTTACGAAAGATTGGC
AAGTGTGCAAGCGCG
Sequence Comment 2L:11100288..11100587dmel-2L-chromosome-r4.1.1.fasta. 5' upstream sequence from genome annotation release 4.1.1. This is not raw data.

Library Name / Clone Name GSV2
Insertion Point 11100587 (based on Drosophila melanogaster genome annotation release 4.1.1 date 20050421)
Flanking Sequence
GGATGATACGGCATGGGGGTACACATTATTAATTTCGCCAGTTGATGAACAGCAACGACT
CGCACACCAACCTGCCCTATCAATACGCAGCAGTCGAATGGTCTCCTTTACTCCTGCTAA
ATGCACCCAGCCGGTACTTGGTAAAACTGGCCTCCAGCAATTGATCGTCTACTTAGCGAA
ACTAAACCATTTAGTTGGCTGCTTCTCGTAAACTCACAAATTTTCGCAAAAAACTTTTTT
TTTTTTGCCGCAAAACCATAGAGGTGTGTAGCGGCGTGTGCTAGGGCAATCGATGGACAG
Sequence Comment 2L:11100587..11100886dmel-2L-chromosome-r4.1.1.fasta. 3' downstream sequence from genome annotation release 4.1.1. This is not raw data.


CLOSE