Detailed Information [202656]
 

Strain Information
DGRC Number 202656
Genotype with FlyBase Link y[1] w[67c23]; P{w[+mC]=GSV6}GS10564 / SM1
Genotype y1 w67c23; P{w+mC=GSV6}GS10564 / SM1
Break points/Insertion Site 31D1
Map Viewer
Related Genes CG5640(CT17732)
Received Date 2/18/03
Original Number 10564
Comments Received from Tokyo Metropolitan University.
Original Comments Vector: GSV6
Location (tagged genes): Intron
Function / Process (tagged genes): function unknown
General Information GS_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Reference Toba G, Ohsako T, Miyata N, Ohtsuka T, Seong KH, Aigaki T.
The gene search system. A method for efficient detection and rapid molecular identification of genes in Drosophila melanogaster.
Genetics (1999) 151(2) 725-37 [RRC reference]
Last update 2020-04-03
Research papers using this strain
[Please submit your publication]
Zhang C, Hong Z, Ma W, Ma D, Qian Y, Xie W, Tie F, Fang M.
Drosophila UTX coordinates with p53 to regulate ku80 expression in response to DNA damage.
PLoS One (2013) 8(11) e78652 [PubMed ID = 24265704] [RRC reference]

Toba G, Ohsako T, Miyata N, Ohtsuka T, Seong KH, Aigaki T.
The gene search system. A method for efficient detection and rapid molecular identification of genes in Drosophila melanogaster.
Genetics (1999) 151(2) 725-37 [PubMed ID = 9927464] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name GSV6
Insertion Point 10276780 (based on Drosophila melanogaster genome annotation release 4.1.1 date 20050421)
Flanking Sequence
AGCATAAGACCTAGACGCAAATGAACTTCATTTGCACATGTAAAATTGGGACTTAGGTAT
AAAAGCTCCTGAAACGATTTGATGGCCCTGGAAAAAAGTAAGTAAATTAATTTTTTTATT
CGTTGTTCTGAATTATTTGTTATAACTTGAATGTATTATTTTAATTTATTAAATTTTGTT
TTATATTTAATTTATAGTAATTGTTTACAGTGAGCGGTGTTTACATAAGTGCATACATAC
TTATGTGCATGCAGT
Sequence Comment 2L:10276481..10276780dmel-2L-chromosome-r4.1.1.fasta. 5' upstream sequence from genome annotation release 4.1.1. This is not raw data.

Library Name / Clone Name GSV6
Insertion Point 10276780 (based on Drosophila melanogaster genome annotation release 4.1.1 date 20050421)
Flanking Sequence
ACCATTTGAACAAACAAATTCAAGTAACATACTTAATTAAACTAGAACTCCGATGATAAG
TGCACAACAGTAAACTTAAATGTTAATCTCCTAAAATATGCCTGCAAAATGCAGGTTTTG
TTTATAAATAACAATAGAACTTGCAGCCGTCGTGTCGGCAGACATGTCTGCGTGCACTCA
AAAAAACGAGACAGACCGTTTCATGGCTTTTTATCAGATAGAATTGCACTGAGAATCATT
GATTATTTGCGTCGGACGCGGTCTGCCTAAATGTTAGCTTTCGAAATTAATAAAATTAAA
Sequence Comment 2L:10276780..10277079dmel-2L-chromosome-r4.1.1.fasta. 3' downstream sequence from genome annotation release 4.1.1. This is not raw data.

CLOSE