Detailed Information [202874]
Strain Information
DGRC Number 202874
Genotype with FlyBase Link w[1118]; P{w[+mC]=GSV6}GS10858 / TM3, Sb[1] Ser[1]
Genotype w1118; P{w+mC=GSV6}GS10858 / TM3, Sb1 Ser1
Break points/Insertion Site 98B2
Map Viewer
Related Genes CG5017(CT16116)
Received Date 2/18/03
Original Number 10858
Comments Received from Tokyo Metropolitan University.
Original Comments Vector: GSV6
Location (tagged genes): Upstream
Function / Process (tagged genes): chaperone
General Information GS_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Reference Toba G, Ohsako T, Miyata N, Ohtsuka T, Seong KH, Aigaki T.
The gene search system. A method for efficient detection and rapid molecular identification of genes in Drosophila melanogaster.
Genetics (1999) 151(2) 725-37 [RRC reference]
Last update 2020-04-03
Research papers using this strain
[Please submit your publication]
Kimura S.
The Nap family proteins, CG5017/Hanabi and Nap1, are essential for Drosophila spermiogenesis.
FEBS Lett (2013) 587(7) 922-9 [PubMed ID = 23454210] [RRC reference]

Toba G, Ohsako T, Miyata N, Ohtsuka T, Seong KH, Aigaki T.
The gene search system. A method for efficient detection and rapid molecular identification of genes in Drosophila melanogaster.
Genetics (1999) 151(2) 725-37 [PubMed ID = 9927464] [RRC reference]

Library & Clone Information
Library Name / Clone Name GSV6
Insertion Point 23737753 (based on Drosophila melanogaster genome annotation release 4.1.1 date 20050421)
Flanking Sequence
GTGTGTGTGTGTGTGTGTCTGGACTTCCGCTTGGCTGAATTTGTTTACACTTTTTTTTCG
CCCGCCGCCACTGGCCCACTCATAATTTCATTTTGAAATGTTTGCCTAAGCGACAATTTC
ACTCTTTTTTTTCACTTTTTTCTGTTGTTTTTCACAGCCGGACATATGGCACTAAGCCTG
GCCCACATTATTAAAACCAGCGACAAAAGACAAGCGACTCTCGGATAGACCAGAAACTGG
GTCCACGGTCCATTT
Sequence Comment 3R:23737454..23737753dmel-3R-chromosome-r4.1.1.fasta. 5' upstream sequence from genome annotation release 4.1.1. This is not raw data.

Library Name / Clone Name GSV6
Insertion Point 23737753 (based on Drosophila melanogaster genome annotation release 4.1.1 date 20050421)
Flanking Sequence
GGCTGAACCTGAACCCTTGGCGGCACAGCACTCAGCACGTGATTTGCATACACTTAGGCC
AGGCTGGCGGCACCCAGTCCAAGCTTTTGGCCCACACTTAATTACATGCCAAATGAAAAG
TTGGCGGAAGCAAACAAAAAATTTTGGGGAAACCAAAAATATATAAACAGGAAAAGAGCA
GGAATTAAATGTGCGTTAAATTGCCAATAAACATGGCCTGCATCTCAATGGGCAAAGTAA
GGCGAAAGGGGTGACTAAAACAGCAATAACACGAGGGTTTAAAAATGTAGCTTAAAAAAA
Sequence Comment 3R:23737753..23738052dmel-3R-chromosome-r4.1.1.fasta. 3' downstream sequence from genome annotation release 4.1.1. This is not raw data.

CLOSE