Detailed Information [204647]

Strain Information
DGRC Number 204647
Genotype with FlyBase Link y[1] w[67c23]; P{w[+mC]=GSV7}GS23019 / TM3, Sb[1] Ser[1]
Genotype y1 w67c23; P{w+mC=GSV7}GS23019 / TM3, Sb1 Ser1
Break points/Insertion Site 093D09
Map Viewer
Received Date 2007
Original Number 23019
Chromosome 3R
Comments A renewed stock, DGRC118090, in which an additional secondary lethal mutation was removed, is present. 12Jul2017. TO.
Received from Tokyo Metropolitan University.
Original Source Toshiro Aigaki. Tokyo Metropolitan University.
Original Comments Nucleotide map: 17202727
Vector: GSV7
General Information GS_lines
Reference Toba G, Ohsako T, Miyata N, Ohtsuka T, Seong KH, Aigaki T.
The gene search system. A method for efficient detection and rapid molecular identification of genes in Drosophila melanogaster.
Genetics (1999) 151(2) 725-37 [PubMed ID = 9927464] [RRC reference]
Last update 2017-07-12
Research papers using this strain
[Please submit your publication]
Savitsky M, Kim M, Kravchuk O, Schwartz YB.
Distinct Roles of Chromatin Insulator Proteins in Control of the Drosophila Bithorax Complex.
Genetics (2016) 202(2) 601-17 [PubMed ID = 26715665] [RRC reference]

Toba G, Ohsako T, Miyata N, Ohtsuka T, Seong KH, Aigaki T.
The gene search system. A method for efficient detection and rapid molecular identification of genes in Drosophila melanogaster.
Genetics (1999) 151(2) 725-37 [PubMed ID = 9927464] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name GSV7
Insertion Point 17202727 (based on Drosophila melanogaster genome annotation release 4.1.1 date 20050421)
Chromosome Band 093D09
Flanking Sequence
CCTTCAGCGCCGAGTGGCTGACGTTGTTCAGGAATACTGCAAGATAGGCGAAGAGAGTAT
AAGGTAAAAAATCACGTAGAGCTACAGATCTGAGCTGAGGGGCACAAACTCACCGATAGC
GTGGGTGTTCGACGGCATCTGAGTGAACATCTTGCGGAAGAAGGGCGAGCAGACGGATAA
CACCAATCGGTGGGCCTTCACTATTTGGCCCTCGGCGGCCAGCGAGACGTCCACCAGGTC
GCCGCGGCATAGCGA
Sequence Comment 3R:17202428..17202727dmel-3R-chromosome-r4.1.1.fasta. 5' upstream sequence from genome annotation release 4.1.1. This is not raw data.

Library Name / Clone Name GSV7
Insertion Point 17202727 (based on Drosophila melanogaster genome annotation release 4.1.1 date 20050421)
Chromosome Band 093D09
Flanking Sequence
ACAAGCTGAATTGCTCGTCGTCCGCCATCTTGGACGAAAATCAATACTTTTCTGTATCTA
TGCGTTTGTTGGCTGCAGGCGAAAAAGTGCAATGCGCGTTTAAAACTCAATGCAGCGAGT
GCTGAAAAATGGCAAAGGCACACACAAAATAGAATGCACTGCAGCCAAAAAAAACTGGGA
AATTTTCACGCGTCTGTCTGTGTGTGCGTGTGTGTAAATTACATTTATCTCGCTTAATGA
CCGCAACCTACTGTGTATATTCACTTGGGGCGCCATTACTCACCTCTTGACTAAATATTT
Sequence Comment 3R:17202727..17203026dmel-3R-chromosome-r4.1.1.fasta. 3' downstream sequence from genome annotation release 4.1.1. This is not raw data.


CLOSE