Detailed Information [206122]
 

Strain Information
DGRC Number 206122
Genotype with FlyBase Link y[1] w[67c23]; P{w[+mC]=GSV6}GS15193 / TM3, Sb[1] Ser[1]
Genotype y1 w67c23; P{w+mC=GSV6}GS15193 / TM3, Sb1 Ser1
Break points/Insertion Site 088D07
Map Viewer
Received Date 1 Februay 2007
Original Number 15193
Chromosome 3R
Comments Received from Tokyo Metropolitan University.
Original Source Toshiro Aigaki. Tokyo Metropolitan University.
Original Comments Nucleotide map: 10744406
Vector: GSV6
General Information GS_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Reference Toba G, Ohsako T, Miyata N, Ohtsuka T, Seong KH, Aigaki T.
The gene search system. A method for efficient detection and rapid molecular identification of genes in Drosophila melanogaster.
Genetics (1999) 151(2) 725-37 [RRC reference]
Last update 2022-02-15
Research papers using this strain
[Please submit your publication]
Lu J, Wang Y, Wang X, Wang D, Pflugfelder GO, Shen J.
The Tbx6 Transcription Factor Dorsocross Mediates Dpp Signaling to Regulate Drosophila Thorax Closure.
Int J Mol Sci (2022) 23(9) [PubMed ID = 35562934] [RRC reference]

Okamoto N, Nakamori R, Murai T, Yamauchi Y, Masuda A, Nishimura T.
A secreted decoy of InR antagonizes insulin/IGF signaling to restrict body growth in Drosophila.
Genes Dev (2013) 27(1) 87-97 [PubMed ID = 23307869] [RRC reference]

Toba G, Ohsako T, Miyata N, Ohtsuka T, Seong KH, Aigaki T.
The gene search system. A method for efficient detection and rapid molecular identification of genes in Drosophila melanogaster.
Genetics (1999) 151(2) 725-37 [PubMed ID = 9927464] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name GSV6
Insertion Point 10744406 (based on Drosophila melanogaster genome annotation release 4.1.1 date 20050421)
Chromosome Band 088D07
Flanking Sequence
TGTAATAATTTTGGAAATCTGCTTAAAAGATATTTTGCTTAAGAAAAAGGTTACTAAATA
TGTTCGCTTTGCATACATTTTTAGGTTCTTATAAATGTCGACAAATTTGAATAGTTTTAT
GAACACTACACGATTTTCCGCTGGTGTAGCCGAAGGGTTTAGAGAACGAAGACGAGCGCA
TAAAAAAGAAATAACAGTGTGAAACAAAACCAAACAAAACAAAACAAAGTGAATGCCGAA
AGAAGAGGCTAATTA
Sequence Comment 3R:10744107..10744406dmel-3R-chromosome-r4.1.1.fasta. 5' upstream sequence from genome annotation release 4.1.1. This is not raw data.

Library Name / Clone Name GSV6
Insertion Point 10744406 (based on Drosophila melanogaster genome annotation release 4.1.1 date 20050421)
Chromosome Band 088D07
Flanking Sequence
GTCCAAATCGAATCGTTGCCGCGAACGCAGCTCTCTTCAAAAGCGGAAAAAATATTTAAA
AAAATATATAGTTCAACCGATCGATCGTGCGAGAAAAACGACATTGACATTCAAGCGGGC
GCGCTAATTGATCCATTGGAAGCCCCCTTAACGCCCGGGTCAAGTGCTCTCAATTGGAAG
TGTCAGGTGGCAGCATGGGGCATCTGCACCCCGTTCCCAACCCCCTTCCGATCCCCATCT
CGATCGCAGTTCCGTTGATACTGCTGTTTTTGGGCGCCTCATCGCCGGTTTTGGCCAGTT
Sequence Comment 3R:10744406..10744705dmel-3R-chromosome-r4.1.1.fasta. 3' downstream sequence from genome annotation release 4.1.1. This is not raw data.

CLOSE