Strain Information | |
---|---|
DGRC Number | 103705 |
Genotype with FlyBase Link | w[*]; P{w[+mW.hs]=GawB}Dl[NP0677] / TM3, Ser[1] |
Genotype | w*; P{w+mW.hs=GawB}DlNP0677 / TM3, Ser1 |
Break points/Insertion Site | 92A2 |
Map Viewer | |
Related Genes | CG14280 CG3581 Dl |
Original Number | 677 |
Chromosome | 3 |
Comments | FlyBase Insertion: P{GawB}NP0677 NP line. Received from the National Institute of Genetics. |
Original Comments | comment1:A, comment2:92A1-A2 |
Balancer | TM3 Ser |
Cluster id | 1557 |
General Information | NP_lines |
Genus | Drosophila |
Subgenus | Sophophora |
Species Group | melanogaster |
Species Subgroup | melanogaster |
Species | melanogaster |
Lethality | lethal |
Embryonic Expression | a small # of cells |
Larval X-gal | multi-circles in leg, sg |
Reference | Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S. GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps. Genesis (2002) 34(1-2) 58-61 [RRC reference] |
Last update | 2020-04-03 |
Research papers using this strain [Please submit your publication] |
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S. GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps. Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference] |
Stock Request |
Library & Clone Information |
---|
Library Name / Clone Name | np / np18235_0807 |
Strand | Plus |
Insertion Point | 15147715 |
Chromosome Band | 3R |
Flanking Sequence | gnnnnngnnggnggngnccccccagggggnnnggggnnntttngttttttttttnggnan naaaacnnnntggtcatnancccctntttgtgtgacttncggtaaagncttcggctattc gacgggnaccaccttttgttatttcatcatgCGCCAGGTGAAGAAGAGCAGTGCATGCAG CCATATTGAAAgatcgaagaatacataagagagaaccgtcgccaaagaacccattattgt tggggtccgttttcaggaagggcaagccatccgacatgtcatcctcttcagaccaatcaa atccatgaagagcanccctgggcataaaatccaacggaattgtggagttatcatgatgag ctgccgagtcaatcgatacagtcaactgtctttgacctttgttactactctcttccgatg atgatgtcgcacttattctatgctgtctcaatgttagaggcatatcagtctccactgaag ccatcttnattttggggnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnatnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnn |
Image Files | ||
---|---|---|
Disc |
|