| Strain Information | |
|---|---|
| DGRC Number | 103988 |
| Genotype with FlyBase Link | y[*] w[*]; P{w[+mW.hs]=GawB}NP1325 / TM6, P{w[-]=UAS-lacZ.UW23-1}UW23-1 |
| Genotype | y* w*; P{w+mW.hs=GawB}NP1325 / TM6, P{w-=UAS-lacZ.UW23-1}UW23-1 |
| Break points/Insertion Site | 98A1 |
| Map Viewer |  |
| Related Genes | CG13978 side |
| Original Number | 1325 |
| Chromosome | 3 |
| Comments | FlyBase Insertion: P{GawB}NP1325 NP line. Received from the National Institute of Genetics. |
| Original Comments | comment1:A, comment2:98A1 |
| Balancer | TM6UW23-1 |
| Cluster id | 1656 |
| General Information | NP_lines |
| Genus | Drosophila |
| Subgenus | Sophophora |
| Species Group | melanogaster |
| Species Subgroup | melanogaster |
| Species | melanogaster |
| Embryonic Expression | cns + pns subset (SG) |
| Larval GFP | cns + pns |
| Larval X-gal | sg |
| Adult GFP | internal |
| Reference | Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S. GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps. Genesis (2002) 34(1-2) 58-61 [RRC reference] |
| Last update | 2020-04-03 |
| Research papers using this strain [Please submit your publication] |
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S. GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps. Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference] |
| Stock Request | |
| Library & Clone Information |
|---|
| Library Name / Clone Name | np / np20275_0807 |
| Strand | Plus |
| Insertion Point | 23252669 |
| Chromosome Band | 3R |
| Flanking Sequence | gggggcaggnttgtttnntttttttggnngantcacacggttgtgaaaatnncccattnt nttggggacnnncggaaagccntcggctattcgacgggnaccaccttntgttatttcatc atgCTACGGGGTAGCAACACATGCCGCATATCATTCACGATTTTTCACTTCGGACGGCGA CGAGCTTCGgatcgaagaatacataagagagaaccgtcgccaaagaacccattattgttg gggtccgttttcaggaagggcaagccatccgacatgtcatcctcttcagaccaatcaaat ccatgaagagcatccctgggcataaaatccaacggaattgtggagttatcatgatgagct gccgagtcaatcgatacagtcaactgtctttgacctttgttactactctcttccgatgat gatgtcgcacttattctatgctgtctcaatgttagaggcatatcagtctccactgaagcc atcttnnnnttnggnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn atnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnntnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnn |