Strain Information | |
---|---|
DGRC Number | 104190 |
Genotype with FlyBase Link | w[*]; P{w[+mW.hs]=GawB}CG32066[NP2400] / TM3, Sb[1] Ser[1] |
Genotype | w*; P{w+mW.hs=GawB}CG32066NP2400 / TM3, Sb1 Ser1 |
Break points/Insertion Site | 67E5 |
Map Viewer | |
Related Genes | CG14153 CG14154 CG32066 |
Original Number | 2400 |
Chromosome | 3 |
Comments | FlyBase Insertion: P{GawB}NP2400 NP line. Received from the National Institute of Genetics. |
Balancer | TM3 Sb Ser |
Cluster id | 1851 |
General Information | NP_lines |
Genus | Drosophila |
Subgenus | Sophophora |
Species Group | melanogaster |
Species Subgroup | melanogaster |
Species | melanogaster |
Embryonic Expression | sg |
Larval GFP | sg |
Larval X-gal | sg |
Adult GFP | internal |
Reference | Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S. GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps. Genesis (2002) 34(1-2) 58-61 [RRC reference] |
Last update | 2020-04-03 |
Research papers using this strain [Please submit your publication] |
Lin TY, Luo J, Shinomiya K, Ting CY, Lu Z, Meinertzhagen IA, Lee CH. Mapping chromatic pathways in the Drosophila visual system. J Comp Neurol (2016) 524(2) 213-27 [PubMed ID = 26179639] [RRC reference] Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S. GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps. Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference] |
Stock Request |
Library & Clone Information |
---|
Library Name / Clone Name | np / np21495_0807 |
Strand | Minus |
Insertion Point | 10600797 |
Chromosome Band | 3L |
Flanking Sequence | atnttttggngngnantcccatttattttgtatacttcggtaagccttcggctatcgacg ggaccaccttatgttatttcatcatgGCCTGGCCCGTAGTGGAAAACCATTTGGAAGCAT TGGCAACACGGGCGGCAGGCAAATTGCGGTGTCACGTACCGCGTAATTAGTAATTAGATT TTCAAGTCAACTGTAATTAGAGGTTAACAAGAGCGAGTGTTGAAAGCAACCGATAGTTGC ATACCTTATgatcgaagaatacataagagagaaccgtcgccaaagaacccattattgttg gggtccgttttcaggaagggcaagccatccgacatgtcatcctcttcagaccaatcaaat ccatgaagagcatccctgggcataaaatccaacggaattgtggagttatcatgatgagct gccgagtcaatcgatacagtcaactgtctttgacctttgttactactctcttccgatgat gatgtcgcacttattctatgctgtctcaatgttagaggcatatcagtctccactgagctn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnn |