Strain Information | |
---|---|
DGRC Number | 104261 |
Genotype with FlyBase Link | w[*]; P{w[+mW.hs]=GawB}chinmo[NP2620] / CyO |
Genotype | w*; P{w+mW.hs=GawB}chinmoNP2620 / CyO |
Break points/Insertion Site | 22A6 |
Map Viewer | |
Related Genes | CG31666 jockey{}288 |
Original Number | 2620 |
Chromosome | 2 |
Comments | FlyBase Insertion: P{GawB}NP2620 NP line. Received from the National Institute of Genetics. |
Balancer | CyO |
Cluster id | 993 |
General Information | NP_lines |
Genus | Drosophila |
Subgenus | Sophophora |
Species Group | melanogaster |
Species Subgroup | melanogaster |
Species | melanogaster |
Lethality | lethal |
Embryonic Expression | scattered cells, cns |
Larval GFP | gut, fb |
Larval X-gal | fb, gut, mt |
Adult GFP | internal |
Reference | Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S. GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps. Genesis (2002) 34(1-2) 58-61 [RRC reference] |
Last update | 2020-04-03 |
Research papers using this strain [Please submit your publication] |
Otsuna H, Ito K. Systematic analysis of the visual projection neurons of Drosophila melanogaster. I. Lobula-specific pathways. J Comp Neurol (2006) 497(6) 928-58 [PubMed ID = 16802334] [RRC reference] Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S. GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps. Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference] |
Stock Request |
Library & Clone Information |
---|
Library Name / Clone Name | np / np23365_0807 |
Strand | Plus |
Insertion Point | 1658091 |
Chromosome Band | 2L |
Flanking Sequence | ggagggnaatgnntgtttnnttttttggtnnngattaaacgtttgtnannaagcccantt tttttntgtacttcggtaagncttcggctatcgacgggnaccaccttatgttatttcatc atgGTCTAAAGTTTCATGGCCTTTTTTTTTAGGGGTTTTTGGGNGTCATGAAAAGGGCAT GGTCCTGTTAAACCTTTAAGAAAGATTTTTTAAATTGTTTGAATTATTATAATTTTATAA AATCTTTGCTTCTCTATTATGAATTCCATATATGAAAATACCTCAGAAGGNNCAAAATTG AATAGAATTGCAGGCAGACCGAAATGTCGATTTAGAGGCTATTACATCACAACCCAGAAC CAAATGCTGATAATTCCTAAAACAGAATGAGCGCGTACAAAAAGCgatcgaagaatacat aagagagaaccgtcgccaaagaacccattattgttggggtccgttttcaggaagggcaag ccatccgacatgtcatcctnttcanaccaatcaaatccatgaagagcatccctgggcata aaatccaacggaattgtggagttatcatgatgagctgccgagtcaatcgatacaggcaac tgtctttgacctttgntactactctcttccgatgatgatgncgcacttattctatgctgt ctcaatgttagaggcatatcagcctccactgagcatnnnnnnnnnggggnnnnggggnnn ncnnnnnnnnnnnnnnaanntnnnnntnnnnanaaaccnaannnnaanngnnnnnnnnnt nnaaaaaaaccnnnagnnnnnnnnnnnnnnaannaaaaangnncnnnnncccccnncnnc nnnngggnccnaaaannncccnnnnnnncnnnnntncntttngnnnnggngnnnaanntt tncccncnnntnnaanganntncccccccnaaaaaannnnnnnnntttnnnnnnnccnnc ccnanccnnttttttnnnnaaaaaaaaaaannnttnnnnnnnnnnnccnnnnnnaaanng gggnnnnntnaaaangggnnngggnaaaaaannnaaaaan |
Image Files | ||
---|---|---|
Disc |
|