| Strain Information | |
|---|---|
| DGRC Number | 104359 |
| Genotype with FlyBase Link | y[*] w[*]; P{w[+mW.hs]=GawB}dve[NP3060] |
| Genotype | y* w*; P{w+mW.hs=GawB}dveNP3060 |
| Break points/Insertion Site | 58D2 |
| Map Viewer |  |
| Related Genes | CG3380 dve CG5819 |
| Original Number | 3060 |
| Chromosome | 2 |
| Comments | Balanced by Cy chromosome 18Dec2012MT FlyBase Insertion: P{GawB}NP3060 NP line. Received from the National Institute of Genetics. |
| Cluster id | 911 |
| General Information | NP_lines |
| Genus | Drosophila |
| Subgenus | Sophophora |
| Species Group | melanogaster |
| Species Subgroup | melanogaster |
| Species | melanogaster |
| Lethality | lethal |
| Embryonic Expression | a small # of cells (TU) |
| Larval GFP | wing pouch (excluded in margin), midgut. |
| Larval X-gal | wing pouch, |
| Adult GFP | internal |
| Reference | Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S. GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps. Genesis (2002) 34(1-2) 58-61 [RRC reference] |
| Last update | 2020-04-03 |
| Research papers using this strain [Please submit your publication] |
Zhao B, Sun J, Zhang X, Mo H, Niu Y, Li Q, Wang L, Zhong Y. Long-term memory is formed immediately without the need for protein synthesis-dependent consolidation in Drosophila. Nat Commun (2019) 10(1) 4550 [PubMed ID = 31591396] [RRC reference] Nakagawa Y, Fujiwara-Fukuta S, Yorimitsu T, Tanaka S, Minami R, Shimooka L, Nakagoshi H. Spatial and temporal requirement of defective proventriculus activity during Drosophila midgut development. Mech Dev (2011) 128(5-6) 258-67 [PubMed ID = 21376808] [RRC reference] Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S. GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps. Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference] |
| Library & Clone Information |
|---|
| Library Name / Clone Name | np / np14245_0727 |
| Strand | Plus |
| Insertion Point | 17287614 |
| Chromosome Band | 2R |
| Flanking Sequence | antacttngngtcactnaacctattttatacttcggtaagcttcggctatcgacgggacc accttatgttatttcatcatgGTCAGTCAGGAGCAGGAGCCCAAGGATTCGGCACGCCAT CTGCCGGAGAAACCAGACAGGCGGACAGCCAGACAGCCTGAACGCCTCAACCTCAACGGT TGGCTTGATTTGCGATTGCCGCATTCGCCAAATTCGATACNCTGCCAATCCTGGTGACGC AGTGACGCgatcgaagaatacataagagagaaccgtcgccaaagaacccattattgttgg ggtccgttttcaggaagggcaagccatccgacatgtcatcctcttcagaccaatcaaatc catgaagagcatccctgggcataaaatccaacggaattgtggagttatcatgatgagctg ccgagtcaatcgatacagtcaactgtctttgacctttgttactactctcttccgatgatg atgtcgcacttattctatgctgtctcaatgttagaggcatatcagtctccactgagcatn ttttttttggggnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnn |
