Detailed Information [105125]
 

Strain Information
DGRC Number 105125
Genotype with FlyBase Link y[*] w[*] P{w[+mW.hs]=GawB}NP6099 / FM7c
Genotype y* w* P{w+mW.hs=GawB}NP6099 / FM7c
Break points/Insertion Site 17A4
Map Viewer
Related Genes CG15061 CG5963
Original Number 6099
Chromosome 1
Comments FlyBase Insertion: P{GawB}NP6099

NP line. Received from the National Institute of Genetics.

Also known as NP6099-Gal4 NP6099 NP6099-GAL4
Balancer FM7c
Cluster id 424
General Information NP_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Embryonic Expression Asp, tracheal subset (hb, pit?).
Larval GFP no gfp signal
Larval X-gal sg
Adult GFP internal
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2020-04-03
Research papers using this strain
[Please submit your publication]
Lin TY, Luo J, Shinomiya K, Ting CY, Lu Z, Meinertzhagen IA, Lee CH.
Mapping chromatic pathways in the Drosophila visual system.
J Comp Neurol (2016) 524(2) 213-27 [PubMed ID = 26179639] [RRC reference]

Zhang X, Liu H, Lei Z, Wu Z, Guo A.
Lobula-specific visual projection neurons are involved in perception of motion-defined second-order motion in Drosophila.
J Exp Biol (2013) 216(Pt 3) 524-34 [PubMed ID = 23077158] [RRC reference]

Umetsu D, Murakami S, Sato M, Tabata T.
The highly ordered assembly of retinal axons and their synaptic partners is regulated by Hedgehog/Single-minded in the Drosophila visual system.
Development (2006) 133(5) 791-800 [PubMed ID = 16439478] [RRC reference]

Otsuna H, Ito K.
Systematic analysis of the visual projection neurons of Drosophila melanogaster. I. Lobula-specific pathways.
J Comp Neurol (2006) 497(6) 928-58 [PubMed ID = 16802334] [RRC reference]

Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np43925_0912
Strand Minus
Insertion Point 18023053
Chromosome Band X
Flanking Sequence
ancnttggngtgcactgaattttgtgtatacttcggtaagcttcggctatcgacgggacc
accttatgttatttcatcatgCTCCAACTCATTCACAGTAGAAACGCAGTGATGCAAATT
GCATTCTTCTATGTTTGTTATTCACTCTATTCACAAATATCCGAAGCTATTTCTGTGGGG
TTCGTAGTTGATGGGGCTTATCAACTCGTAATGCCTATTTATATATATAGTCACTCCTGA
GGgatcgaagaatacataagagagaaccgtcgccaaagaacccattattgttggggtccg
ttttcaggaagggcaagccatccgacatgtcatcctcttcagaccaatcaaatccatgaa
gagcatccctgggcataaaatccaacggaattgtggagttatcatgatgagctgccgagt
caatcgatacagtcaactgtctttgacctttgttactactctcttccgatgatgatgtcg
cacttattctatgctgtctcaatgttagaggcatatcagtctccactgagcatcttnttt
ttngggnnnnnnnnnnnnnnnnnnnnnnnnnnnnncnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnntnnnnnnannnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn

Image Files
Embryo

e1 (->Large)

e2 (->Large)

CLOSE