Strain Information | |
---|---|
DGRC Number | 105125 |
Genotype with FlyBase Link | y[*] w[*] P{w[+mW.hs]=GawB}NP6099 / FM7c |
Genotype | y* w* P{w+mW.hs=GawB}NP6099 / FM7c |
Break points/Insertion Site | 17A4 |
Map Viewer | |
Related Genes | CG15061 CG5963 |
Original Number | 6099 |
Chromosome | 1 |
Comments | FlyBase Insertion: P{GawB}NP6099 NP line. Received from the National Institute of Genetics. |
Also known as | NP6099-Gal4 NP6099 NP6099-GAL4 |
Balancer | FM7c |
Cluster id | 424 |
General Information | NP_lines |
Genus | Drosophila |
Subgenus | Sophophora |
Species Group | melanogaster |
Species Subgroup | melanogaster |
Species | melanogaster |
Embryonic Expression | Asp, tracheal subset (hb, pit?). |
Larval GFP | no gfp signal |
Larval X-gal | sg |
Adult GFP | internal |
Reference | Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S. GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps. Genesis (2002) 34(1-2) 58-61 [RRC reference] |
Last update | 2020-04-03 |
Research papers using this strain [Please submit your publication] |
Lin TY, Luo J, Shinomiya K, Ting CY, Lu Z, Meinertzhagen IA, Lee CH. Mapping chromatic pathways in the Drosophila visual system. J Comp Neurol (2016) 524(2) 213-27 [PubMed ID = 26179639] [RRC reference] Zhang X, Liu H, Lei Z, Wu Z, Guo A. Lobula-specific visual projection neurons are involved in perception of motion-defined second-order motion in Drosophila. J Exp Biol (2013) 216(Pt 3) 524-34 [PubMed ID = 23077158] [RRC reference] Umetsu D, Murakami S, Sato M, Tabata T. The highly ordered assembly of retinal axons and their synaptic partners is regulated by Hedgehog/Single-minded in the Drosophila visual system. Development (2006) 133(5) 791-800 [PubMed ID = 16439478] [RRC reference] Otsuna H, Ito K. Systematic analysis of the visual projection neurons of Drosophila melanogaster. I. Lobula-specific pathways. J Comp Neurol (2006) 497(6) 928-58 [PubMed ID = 16802334] [RRC reference] Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S. GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps. Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference] |
Stock Request |
Library & Clone Information |
---|
Library Name / Clone Name | np / np43925_0912 |
Strand | Minus |
Insertion Point | 18023053 |
Chromosome Band | X |
Flanking Sequence | ancnttggngtgcactgaattttgtgtatacttcggtaagcttcggctatcgacgggacc accttatgttatttcatcatgCTCCAACTCATTCACAGTAGAAACGCAGTGATGCAAATT GCATTCTTCTATGTTTGTTATTCACTCTATTCACAAATATCCGAAGCTATTTCTGTGGGG TTCGTAGTTGATGGGGCTTATCAACTCGTAATGCCTATTTATATATATAGTCACTCCTGA GGgatcgaagaatacataagagagaaccgtcgccaaagaacccattattgttggggtccg ttttcaggaagggcaagccatccgacatgtcatcctcttcagaccaatcaaatccatgaa gagcatccctgggcataaaatccaacggaattgtggagttatcatgatgagctgccgagt caatcgatacagtcaactgtctttgacctttgttactactctcttccgatgatgatgtcg cacttattctatgctgtctcaatgttagaggcatatcagtctccactgagcatcttnttt ttngggnnnnnnnnnnnnnnnnnnnnnnnnnnnnncnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnntnnnnnnannnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn |