Strain Information | |
---|---|
DGRC Number | 105257 |
Genotype with FlyBase Link | y[*] w[*]; P{w[+mW.hs]=GawB}ato[NP6558] / TM6, P{w[-]=UAS-lacZ.UW23-1}UW23-1 |
Genotype | y* w*; P{w+mW.hs=GawB}atoNP6558 / TM6, P{w-=UAS-lacZ.UW23-1}UW23-1 |
Break points/Insertion Site | 84F6 |
Map Viewer | |
Related Genes | CG11671 ato CG9630 |
Original Number | 6558 |
Chromosome | 3 |
Comments | FlyBase Insertion: P{GawB}NP6558 NP line. Received from the National Institute of Genetics. |
Original Comments | comment1:A, comment2:84F1-F7 |
Balancer | TM6UW23-1 |
Cluster id | 1381 |
General Information | NP_lines |
Genus | Drosophila |
Subgenus | Sophophora |
Species Group | melanogaster |
Species Subgroup | melanogaster |
Species | melanogaster |
Embryonic Expression | leg disc? stripes in abdomenal epi, |
Larval GFP | sg |
Larval X-gal | ch organ, PNS, |
Adult GFP | internal |
Reference | Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S. GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps. Genesis (2002) 34(1-2) 58-61 [RRC reference] |
Last update | 2020-04-03 |
Research papers using this strain [Please submit your publication] |
Lin TY, Luo J, Shinomiya K, Ting CY, Lu Z, Meinertzhagen IA, Lee CH. Mapping chromatic pathways in the Drosophila visual system. J Comp Neurol (2016) 524(2) 213-27 [PubMed ID = 26179639] [RRC reference] Chai PC, Cruchet S, Wigger L, Benton R. Sensory neuron lineage mapping and manipulation in the Drosophila olfactory system. Nat Commun (2019) 10(1) 643 [PubMed ID = 30733440] [RRC reference] Okumura M, Kato T, Miura M, Chihara T. Hierarchical axon targeting of Drosophila olfactory receptor neurons specified by the proneural transcription factors Atonal and Amos. Genes Cells (2016) 21(1) 53-64 [PubMed ID = 26663477] [RRC reference] Otsuna H, Ito K. Systematic analysis of the visual projection neurons of Drosophila melanogaster. I. Lobula-specific pathways. J Comp Neurol (2006) 497(6) 928-58 [PubMed ID = 16802334] [RRC reference] Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S. GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps. Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference] |
Stock Request |
Library & Clone Information |
---|
Library Name / Clone Name | np / np46535_0912 |
Strand | Plus |
Insertion Point | 4103686 |
Chromosome Band | 3R |
Flanking Sequence | tttttagacgtgcactgaatttaagtgtatacttcggtaagcttcggctatcgacgggac caccttatgttatttcatcatgGTGGCAACTCGTTTACCTGCCCCCCTACCTGCCTTTCA GGCCCTTCTGACCGTCGTGGTGGATTTGTGAGTATAAATAGGGCCGAAAGGACGAGAGAC CAGTCAGAAACCCGCCAGCACTCGCAGCGTTCGTACCGTTTCATCCAGCAACATAACACC ACCATACAGCAGCAGCAACATGTCGTCCAGTGAgatcgaagaatacataagagagaaccg tcgccaaagaacccattattgttggggtccgttttcaggaagggcaagccatccgacatg tcatcctcttcagaccaatcaaatccatgaagagcatccctgggcataaaatccaacgga attgtggagttatcatgatgagctgccgagtcaatcgatacagtcaactgtctttgaccc tttgttactactctcttccgatgatgatgtcgcacttattctatgctgtctcaatgttag aggcatatcagtctccctngctcccttntnnnngggggggggnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn |