Strain Information | |
---|---|
DGRC Number | 105362 |
Genotype with FlyBase Link | y[*] w[*]; P{w[+mW.hs]=GawB}NP7088 / CyO, P{w[-]=UAS-lacZ.UW14}UW14 |
Genotype | y* w*; P{w+mW.hs=GawB}NP7088 / CyO, P{w-=UAS-lacZ.UW14}UW14 |
Break points/Insertion Site | 49D6; -; 49D7 |
Map Viewer | |
Related Genes | Nmda1 Aats-asp |
Original Number | 7088 |
Chromosome | 2 |
Comments | FlyBase Insertion: P{GawB}NP7088 NP line. Received from the National Institute of Genetics. |
Balancer | CyUW14 |
Cluster id | 717 |
General Information | NP_lines |
Genus | Drosophila |
Subgenus | Sophophora |
Species Group | melanogaster |
Species Subgroup | melanogaster |
Species | melanogaster |
Lethality | lethal |
Embryonic Expression | weak |
Larval GFP | midgut |
Larval X-gal | wing margin and pouch, mg |
Adult GFP | internal |
Reference | Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S. GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps. Genesis (2002) 34(1-2) 58-61 [RRC reference] |
Last update | 2020-04-03 |
Research papers using this strain [Please submit your publication] |
Hermanns T, Graf-Boxhorn S, Poeck B, Strauss R. Octopamine mediates sugar relief from a chronic-stress-induced depression-like state in Drosophila. Curr Biol (2022) 32(18) 4048-4056.e3 [PubMed ID = 35914533] [RRC reference] Matsuo E, Seki H, Asai T, Morimoto T, Miyakawa H, Ito K, Kamikouchi A. Organization of projection neurons and local neurons of the primary auditory center in the fruit fly Drosophila melanogaster. J Comp Neurol (2016) 524(6) 1099-164 [PubMed ID = 26762251] [RRC reference] Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S. GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps. Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference] |
Stock Request |
Library & Clone Information |
---|
Library Name / Clone Name | np / np33895_0907 |
Strand | Plus |
Insertion Point | 7945003 |
Chromosome Band | 2R |
Flanking Sequence | annctttnggggaaaaaacccnttttttggtatacttcggtaagccttcggctatcgacg ggaccaccttatgttatttcatcatgCTCTAGACTGCACCGCGCTGGTGGCATGTGCAAT AGTACACGACGCTCGTGAAATCAATTCGTTTGTGTATTAAAAGGGCAAgatcgaagaata cataagagagaaccgtcgccaaagaacccattattgttgnnttncgttttcaggaagggc aagccatccgacatgtcatcctcttcagaccaatcaaatccatgaagagcatccctgggc ataaaatccaacggaattgtggagttatcatgatgagctgccgagtcaatcgatacagtc aactgtctttgacctttgttactactctcttccgatgatgatgtcgcacttattctatgc tgtctcaatgttagaggcatatcagtctccactgaagccatcttnntnttggnnnnnnnn tnnnnnnnganganngnngnnnnnnnttanttnnntggntnnannnnntnggnnggnang nnnannnnnnncannnnaatganacccnnatnnnnnnnntnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnngnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn |
Image Files | ||
---|---|---|
Disc |
|