Strain Information | |
---|---|
DGRC Number | 105423 |
Genotype with FlyBase Link | y[*] w[*]; P{w[+mW.hs]=GawB}Dek[NP7318] / CyO, P{w[-]=UAS-lacZ.UW14}UW14 |
Genotype | y* w*; P{w+mW.hs=GawB}DekNP7318 / CyO, P{w-=UAS-lacZ.UW14}UW14 |
Break points/Insertion Site | 53D14 |
Map Viewer | |
Related Genes | l(2)04154 Fen1 Psi |
Original Number | 7318 |
Chromosome | 2 |
Comments | FlyBase Insertion: P{GawB}NP7318 NP line. Received from the National Institute of Genetics. |
Balancer | CyUW14 |
Cluster id | 809 |
General Information | NP_lines |
Genus | Drosophila |
Subgenus | Sophophora |
Species Group | melanogaster |
Species Subgroup | melanogaster |
Species | melanogaster |
Lethality | lethal |
Embryonic Expression | cns |
Larval GFP | sg |
Larval X-gal | sg |
Reference | Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S. GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps. Genesis (2002) 34(1-2) 58-61 [RRC reference] |
Last update | 2020-04-03 |
Research papers using this strain [Please submit your publication] |
Lin TY, Luo J, Shinomiya K, Ting CY, Lu Z, Meinertzhagen IA, Lee CH. Mapping chromatic pathways in the Drosophila visual system. J Comp Neurol (2016) 524(2) 213-27 [PubMed ID = 26179639] [RRC reference] Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S. GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps. Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference] |
Stock Request |
Library & Clone Information |
---|
Library Name / Clone Name | np / np06665_0711 |
Strand | Plus |
Insertion Point | 11920956 |
Chromosome Band | 2R |
Flanking Sequence | gggcnngngntgtangtttttttnggnnggannaacgtngttcataanccatttttttgn acttncggtaagactcccggctatcgacgggnaccaccttatgttatttcatcatgCTTT GGGCTACTTATNGGGAGAGTTCCGATGTGGTGCTGCGGTCTAAAGCGTCGCTCCTTGTGT CTCTCTTGTTTACGGCGCTATGCTGATGTTGGCATGTGGTTCgatcgaagaatacataag agagaaccgtcgccaaagaacccattattgttggggtccgngnggaggaagggcaagcca tccgacatgtcatcctcttcagaccaatcaaatccatgaagagcatccctgggcataaaa tccaacggaattgtggagttatcatgatgagctgccgagtcaatcgatacagtcaactgt ctttgacctttgttactactctcttccgatgatgatgtcgcacttattctatgctgtctc aatgttagaggcatatcagtctccactgaagccatcnnantctggnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnn |