Detailed Information [109716]
Strain Information
DGRC Number 109716
Genotype with FlyBase Link w[1118]; PBac{EGFP-IV}zetaCOP[KM0086] / TM6C, Sb[1]
Genotype w1118; PBac{EGFP-IV}ζCOPKM0086 / TM6C, Sb1
Break points/Insertion Site 73B6
Related Genes zetaCOP
Received Date 22 November 2012
Original Number 86
Chromosome 3L
Comments Expression Photo: KM0086
Original Source Hiroshi Matsubayashi and Masa-Toshi Yamamoto, Kyoto Institute of Technology
Original Comments Insertion site: 3L:16665537 (based on Drosophila melanogaster genome annotation release 5)
Cytological map: 73B6
Inserted gene: zetaCOP
Protein trap?: Yes
Insertion into Intron or Exon?: Intron(CDS), Exon(CDS)
Orientation of piggyTrap (F:Forward/R:Reverse): F
Orientation of GFP exon and its frame against inserted gene: same orientation and frame(coding intron) , but wrong frame(coding exon)
General Information Kyoto_piggyTrap
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Lethality lethal
Last update 2020-04-03
Research papers using this strain
[Please submit your publication]

Library & Clone Information
Insertion Point 3L:16665537
Chromosome Band 73B6
Flanking Sequence 
NNNTTAACNCNTGNCCCAANNTGATATCAGAAGGAAGAAAAACAGCTGCAGATAAATAAA
CCTCGATATACAGACCGATAAAACACATGCGTCAAANNTACGCATGACTATCTNCTAACG
TACGTCGCAATATGATTATCTCCTCTAGGGTTAAGGGTGTTAGTTACCTGGGCAACGGTC
TGTTCGGCAATGGGAATGTCATCGTTGCGCAGATCTTGAAGTTCACCTTGATGCCGTTCT
TCTGCTTGTCGGCCA
Sequence Comment iPCR (3' sequence). Insertion point based on Drosophila melanogaster genome annotation release 5.

CLOSE