Detailed Information [109719]
Strain Information
DGRC Number 109719
Genotype with FlyBase Link w[1118]; PBac{EGFP-IV}cpo[KM0015] / TM6C, Sb[1]
Genotype w1118; PBac{EGFP-IV}cpoKM0015 / TM6C, Sb1
Break points/Insertion Site 99D1
Related Genes cpo
Received Date 22 November 2012
Original Number 15
Chromosome 3R
Comments Expression Photo: KM0015

Original Source Hiroshi Matsubayashi and Masa-Toshi Yamamoto, Kyoto Institute of Technology
Original Comments Insertion site: 3R:13775330 (based on Drosophila melanogaster genome annotation release 5)
Cytological map: 99D1
Inserted gene: cpo
Protein trap?: ??
Insertion into Intron or Exon?: Intron (5'UTR)
Orientation of piggyTrap (F:Forward/R:Reverse): R
Orientation of GFP exon and its frame against inserted gene: same orientation and frame, but premature stop codon?
General Information Kyoto_piggyTrap
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Lethality lethal
Last update 2020-04-03
Research papers using this strain
[Please submit your publication]

Library & Clone Information
Insertion Point 3R:13775330
Chromosome Band 99D1
Flanking Sequence
NNNNNNNTACTTGTCCNNAANGNTATCTGTAAGGACNCAAAACCTAGCTGCAGNTAAATA
AACCTCGNTATACAGACCGATAAAACACATGCGTCAAANCTACGCATGACTATCNCTAAC
GTACGTCGCAATATGACTATCTCNTCTAGGGTTAATGAAAACCCTAATATACTGTTTACA
ATTGTTGCATACTGCCCAGGTGCGCTTCGTCNCTACNTTGATCTTGAANTTCNCNTTNNT
GCCGTTTTTCTGCTT
Sequence Comment iPCR (3' sequence). Insertion point based on Drosophila melanogaster genome annotation release 5.

CLOSE