Detailed Information [109720]
Strain Information
DGRC Number 109720
Genotype with FlyBase Link w[1118]; PBac{EGFP-IV}Bsg[KM0038] / SM6a
Genotype w1118; PBac{EGFP-IV}BsgKM0038 / SM6a
Break points/Insertion Site 28E4
Related Genes Bsg
Received Date 22 November 2012
Original Number 38
Chromosome 2L
Comments Expression Photo: KM0038

Original Source Hiroshi Matsubayashi and Masa-Toshi Yamamoto, Kyoto Institute of Technology
Original Comments Insertion site: 2L:8087144 (based on Drosophila melanogaster genome annotation release 5)
Cytological map: 28E4
Inserted gene: Bsg
Protein trap?: No
Insertion into Intron or Exon?: Intron (5'UTR)
Orientation of piggyTrap (F:Forward/R:Reverse): R
Orientation of GFP exon and its frame against inserted gene: same orientation but wrong frame and premature stop codon
General Information Kyoto_piggyTrap
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Lethality lethal
Last update 2020-04-03
Research papers using this strain
[Please submit your publication]

Library & Clone Information
Insertion Point 2L:8087144
Chromosome Band 28E4
Flanking Sequence
NATTCCTTGCTCCCANTTTGATTATCTGTAAGGCAAGAAAAAATTAGCTGGCAGATAAAT
AAACCTCGATATACAGCACCGATAAAACACATGCGTCAATTTTACGCATGATTATCTTTA
ACGTACGTCGCAATATGATTATCTTTCTAGGGTTAAGATAAAGCCCCAATGCAGTACTTT
GAACAAATACGGGACTCCGTCCGTCCGTCCGTATCACCAACACCAATACTACCGCAACCA
AAAACCACACCAACG
Sequence Comment iPCR (3' sequence). Insertion point based on Drosophila melanogaster genome annotation release 5.

CLOSE