| Strain Information | |
|---|---|
| DGRC Number | 109730 |
| Genotype with FlyBase Link | w[1118]; PBac{EGFP-IV}mub[KM0121] / TM6C, Sb[1] |
| Genotype | w1118; PBac{EGFP-IV}mubKM0121 / TM6C, Sb1 |
| Break points/Insertion Site | 79A3 |
| Related Genes | mub |
| Received Date | 22 November 2012 |
| Original Number | 121 |
| Chromosome | 3L |
| Original Source | Hiroshi Matsubayashi and Masa-Toshi Yamamoto, Kyoto Institute of Technology |
| Original Comments | Insertion site: 3L:21896719 (based on Drosophila melanogaster genome annotation release 5) Cytological map: 79A3 Inserted gene: mub Protein trap?: No Insertion into Intron or Exon?: Intron (5'UTR) Orientation of piggyTrap (F:Forward/R:Reverse): R Orientation of GFP exon and its frame against inserted gene: same orientation but wrong frame, premature stop |
| General Information | Kyoto_piggyTrap |
| Genus | Drosophila |
| Subgenus | Sophophora |
| Species Group | melanogaster |
| Species Subgroup | melanogaster |
| Species | melanogaster |
| Lethality | lethal |
| Last update | 2020-04-03 |
| Research papers using this strain [Please submit your publication] |
|
| Stock Request | |
| Library & Clone Information |
|---|
| Insertion Point | 3L:21896719 |
| Chromosome Band | 79A3 |
| Flanking Sequence | ttaataacatttcggtcatgatttag |
| Sequence Comment | iPCR (3' sequence). Insertion point based on Drosophila melanogaster genome annotation release 5. |