Detailed Information [109739]
Strain Information
DGRC Number 109739
Genotype with FlyBase Link w[1118]; PBac{EGFP-IV}CG30497[KM0125]
Genotype w1118; PBac{EGFP-IV}CG30497KM0125
Break points/Insertion Site 43E16
Related Genes CG30497
Received Date 22 November 2012
Original Number 125
Chromosome 2R
Original Source Hiroshi Matsubayashi and Masa-Toshi Yamamoto, Kyoto Institute of Technology
Original Comments Insertion site: 2R:3667586 (based on Drosophila melanogaster genome annotation release 5)
Cytological map: 43E16
Inserted gene: CG30497
Protein trap?: No
Insertion into Intron or Exon?: Intron (5'UTR)
Orientation of piggyTrap (F:Forward/R:Reverse): F
Orientation of GFP exon and its frame against inserted gene: same orientation, but wrong frame
General Information Kyoto_piggyTrap
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Last update 2020-04-03
Research papers using this strain
[Please submit your publication]

Library & Clone Information
Insertion Point 2R:3667586
Chromosome Band 43E16
Flanking Sequence
TTTCTTGTCCCTTTTGTTTCTGAANGAAGAAAAAATAGNNGCAGATAAATAAACCTCGAT
ATACAGACCGATAAAACACATGCNTCAAANNTACGCATGANTATCTNNTAACGTACGTCG
CAATATGATTATCTCCTCTAGGGTCTAATGAAGCCAAAATCACTNTATGAAAGCGTATTC
CTCACATGTTGCCCATCCACCCCTTTTTTTTGTGAGTCTTTATCACACATTTTGTTTTTG
ATTAACTGCTGTGGG
Sequence Comment iPCR (3' sequence). Insertion point based on Drosophila melanogaster genome annotation release 5.

CLOSE