Detailed Information [109740]
 

Strain Information
DGRC Number 109740
Genotype with FlyBase Link w[1118]; PBac{EGFP-IV}CG12163[KM0156] / TM6C, Sb[1]
Genotype w1118; PBac{EGFP-IV}CG12163KM0156 / TM6C, Sb1
Break points/Insertion Site 82F6
Related Genes CG12163
Received Date 22 November 2012
Original Number 156
Chromosome 3R
Comments Expression Photo: KM0156

Original Source Hiroshi Matsubayashi and Masa-Toshi Yamamoto, Kyoto Institute of Technology
Original Comments Insertion site: 3R:1065619 (based on Drosophila melanogaster genome annotation release 5)
Cytological map: 82F6
Inserted gene: CG12163
Protein trap?: Yes
Insertion into Intron or Exon?: Intron (CDS)
Orientation of piggyTrap (F:Forward/R:Reverse): F
Orientation of GFP exon and its frame against inserted gene: same orientation and frame
General Information Kyoto_piggyTrap
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Last update 2020-04-03
Research papers using this strain
[Please submit your publication]
Tsarouhas V, Liu D, Tsikala G, Engstrom Y, Strigini M, Samakovlis C.
A surfactant lipid layer of endosomal membranes facilitates airway gas filling in Drosophila.
Curr Biol (2023) 33(23) 5132-5146.e5 [PubMed ID = 37992718] [RRC reference]
Stock Request

Library & Clone Information
Insertion Point 3R:1065619
Chromosome Band 82F6
Flanking Sequence
GNCCNTTTTGTTATCTGAAGGAAGAAAAANNTAGCTGCAGATAAATAAACCTCGATATAC
AGACCGATAAAACACATGCGTCAACCTTACGCATGATTATCTTTAACGTACGTCGCAATA
TGATTATCTTTCTAGGGTTAAAAGCCTTTCAAACGGATGCCATTTAATTCCAGGCTAGTT
CCAACTTTTTATGGAATCTCGGAAATATTCCAATCTCGATTTATAAGCTCAGTAAACCAT
AAAAAGTGTTCACCA
Sequence Comment iPCR (3' sequence). Insertion point based on Drosophila melanogaster genome annotation release 5.

CLOSE