Strain Information | |
---|---|
DGRC Number | 109740 |
Genotype with FlyBase Link | w[1118]; PBac{EGFP-IV}CG12163[KM0156] / TM6C, Sb[1] |
Genotype | w1118; PBac{EGFP-IV}CG12163KM0156 / TM6C, Sb1 |
Break points/Insertion Site | 82F6 |
Related Genes | CG12163 |
Received Date | 22 November 2012 |
Original Number | 156 |
Chromosome | 3R |
Comments | Expression Photo: KM0156 |
Original Source | Hiroshi Matsubayashi and Masa-Toshi Yamamoto, Kyoto Institute of Technology |
Original Comments | Insertion site: 3R:1065619 (based on Drosophila melanogaster genome annotation release 5) Cytological map: 82F6 Inserted gene: CG12163 Protein trap?: Yes Insertion into Intron or Exon?: Intron (CDS) Orientation of piggyTrap (F:Forward/R:Reverse): F Orientation of GFP exon and its frame against inserted gene: same orientation and frame |
General Information | Kyoto_piggyTrap |
Genus | Drosophila |
Subgenus | Sophophora |
Species Group | melanogaster |
Species Subgroup | melanogaster |
Species | melanogaster |
Last update | 2020-04-03 |
Research papers using this strain [Please submit your publication] |
Tsarouhas V, Liu D, Tsikala G, Engstrom Y, Strigini M, Samakovlis C. A surfactant lipid layer of endosomal membranes facilitates airway gas filling in Drosophila. Curr Biol (2023) 33(23) 5132-5146.e5 [PubMed ID = 37992718] [RRC reference] |
Stock Request |
Library & Clone Information |
---|
Insertion Point | 3R:1065619 |
Chromosome Band | 82F6 |
Flanking Sequence | GNCCNTTTTGTTATCTGAAGGAAGAAAAANNTAGCTGCAGATAAATAAACCTCGATATAC AGACCGATAAAACACATGCGTCAACCTTACGCATGATTATCTTTAACGTACGTCGCAATA TGATTATCTTTCTAGGGTTAAAAGCCTTTCAAACGGATGCCATTTAATTCCAGGCTAGTT CCAACTTTTTATGGAATCTCGGAAATATTCCAATCTCGATTTATAAGCTCAGTAAACCAT AAAAAGTGTTCACCA |
Sequence Comment | iPCR (3' sequence). Insertion point based on Drosophila melanogaster genome annotation release 5. |