| Strain Information | |
|---|---|
| DGRC Number | 109740 |
| Genotype with FlyBase Link | w[1118]; PBac{EGFP-IV}CG12163[KM0156] / TM6C, Sb[1] |
| Genotype | w1118; PBac{EGFP-IV}CG12163KM0156 / TM6C, Sb1 |
| Break points/Insertion Site | 82F6 |
| Related Genes | CG12163 |
| Received Date | 22 November 2012 |
| Original Number | 156 |
| Chromosome | 3R |
| Comments | Expression Photo: KM0156 |
| Original Source | Hiroshi Matsubayashi and Masa-Toshi Yamamoto, Kyoto Institute of Technology |
| Original Comments | Insertion site: 3R:1065619 (based on Drosophila melanogaster genome annotation release 5) Cytological map: 82F6 Inserted gene: CG12163 Protein trap?: Yes Insertion into Intron or Exon?: Intron (CDS) Orientation of piggyTrap (F:Forward/R:Reverse): F Orientation of GFP exon and its frame against inserted gene: same orientation and frame |
| General Information | Kyoto_piggyTrap |
| Genus | Drosophila |
| Subgenus | Sophophora |
| Species Group | melanogaster |
| Species Subgroup | melanogaster |
| Species | melanogaster |
| Last update | 2026-08-04 |
| Research papers using this strain [Please submit your publication] |
Tsarouhas V, Liu D, Tsikala G, Engstrom Y, Strigini M, Samakovlis C. A surfactant lipid layer of endosomal membranes facilitates airway gas filling in Drosophila. Curr Biol (2023) 33(23) 5132-5146.e5 [PubMed ID = 37992718] [RRC reference] |
| Stock Request | |
| Library & Clone Information |
|---|
| Insertion Point | 3R:1065619 |
| Chromosome Band | 82F6 |
| Flanking Sequence | GNCCNTTTTGTTATCTGAAGGAAGAAAAANNTAGCTGCAGATAAATAAACCTCGATATAC AGACCGATAAAACACATGCGTCAACCTTACGCATGATTATCTTTAACGTACGTCGCAATA TGATTATCTTTCTAGGGTTAAAAGCCTTTCAAACGGATGCCATTTAATTCCAGGCTAGTT CCAACTTTTTATGGAATCTCGGAAATATTCCAATCTCGATTTATAAGCTCAGTAAACCAT AAAAAGTGTTCACCA |
| Sequence Comment | iPCR (3' sequence). Insertion point based on Drosophila melanogaster genome annotation release 5. |