Detailed Information [109745]
 

Strain Information
DGRC Number 109745
Genotype with FlyBase Link w[1118]; PBac{EGFP-IV}GlyP[KM0224] / SM6a
Genotype w1118; PBac{EGFP-IV}GlyPKM0224 / SM6a
Break points/Insertion Site 22D1
Related Genes GlyP
Received Date 22 November 2012
Original Number 224
Chromosome 2L
Original Source Hiroshi Matsubayashi and Masa-Toshi Yamamoto, Kyoto Institute of Technology
Original Comments Insertion site: 2L:2132742 (based on Drosophila melanogaster genome annotation release 5)
Cytological map: 22D1
Inserted gene: GlyP
Protein trap?: Yes
Insertion into Intron or Exon?: Intron (CDS)
Orientation of piggyTrap (F:Forward/R:Reverse): R
Orientation of GFP exon and its frame against inserted gene: same orientation and frame
General Information Kyoto_piggyTrap
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Lethality lethal
Last update 2026-08-04
Research papers using this strain
[Please submit your publication]
Stock Request

Library & Clone Information
Insertion Point 2L:2132742
Chromosome Band 22D1
Flanking Sequence
TACTCNTGCCNCTTTTGTTATCTGAAGGAAGAAAAANNTAGCTGCAGATAAATAAACCTC
GATATACAGACCGATAAAACACATGCGTCAAACTTACGCATGATTATCTTTAACGTACGT
CGCAATATGATTATCTTTCTAGGGTTAAGTATCCATAAGATACAATCGTCGTCAGTTCAT
ATATTTCTATTTAGATGGTTGCGTGAGCTAATTGCATGTGGGGGGACAACTAAACAAAAT
CGGGCCTATAAAAGT
Sequence Comment iPCR (3' sequence). Insertion point based on Drosophila melanogaster genome annotation release 5.

CLOSE