Detailed Information [109746]
Strain Information
DGRC Number 109746
Genotype with FlyBase Link w[1118]; PBac{EGFP-IV}bel[KM0207]
Genotype w1118; PBac{EGFP-IV}belKM0207
Break points/Insertion Site 85A5
Related Genes bel
Received Date 22 November 2012
Original Number 207
Chromosome 3R
Comments Expression Photo: KM0207

Original Source Hiroshi Matsubayashi and Masa-Toshi Yamamoto, Kyoto Institute of Technology
Original Comments Insertion site: 3R:4484619 (based on Drosophila melanogaster genome annotation release 5)
Cytological map: 85A5
Inserted gene: bel
Protein trap?: Yes
Insertion into Intron or Exon?: Intron (CDS)
Orientation of piggyTrap (F:Forward/R:Reverse): F
Orientation of GFP exon and its frame against inserted gene: same orientation and frame
General Information Kyoto_piggyTrap
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Last update 2020-04-03
Research papers using this strain
[Please submit your publication]

Library & Clone Information
Insertion Point 3R:4484619
Chromosome Band 85A5
Flanking Sequence
TNTTCCTTGCNCCCTTTTGTTTCTGAACCAAGAAAAAATTAGCTGCAGATAANTAAATTT
CGATATACAGACCGATAAAACACATGCGTCAATTTTACGCATGATTATCTTTAACGTACG
TCGCAATATGATTATCTTTCNAGGGTTAAAGCTTCGANTTTAGTGCTCTCCCTGTNAGCG
TCTCTCTCGCCGNCGCANGCAAGCTATTATNNNAGGGNGGGNGGGGGNNNNGTNTCCCAN
CAAAAAACNCCCCTG
Sequence Comment iPCR (3' sequence). Insertion point based on Drosophila melanogaster genome annotation release 5.

CLOSE