Detailed Information [109748]
Strain Information
DGRC Number 109748
Genotype with FlyBase Link w[1118]; PBac{EGFP-IV}aralar1[KM0201] / TM6C, Sb[1]
Genotype w1118; PBac{EGFP-IV}aralar1KM0201 / TM6C, Sb1
Break points/Insertion Site 99F4
Related Genes aralar1
Received Date 22 November 2012
Original Number 201
Chromosome 3R
Comments Expression Photo: KM0201

Original Source Hiroshi Matsubayashi and Masa-Toshi Yamamoto, Kyoto Institute of Technology
Original Comments Insertion site: 3R:26274970 (based on Drosophila melanogaster genome annotation release 5)
Cytological map: 99F4
Inserted gene: aralar1
Protein trap?: Yes
Insertion into Intron or Exon?: Intron (CDS)
Orientation of piggyTrap (F:Forward/R:Reverse): F
Orientation of GFP exon and its frame against inserted gene: same orientation and frame
General Information Kyoto_piggyTrap
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Last update 2020-04-03
Research papers using this strain
[Please submit your publication]

Library & Clone Information
Insertion Point 3R:26274970
Chromosome Band 99F4
Flanking Sequence
GGGGGGGGTAAACGCAANGNCAACAACAAAACATAAGAAAAAAGAAAAAACTAGNTGCAG
ATAAATAAACCTCGATATACAGACCGATAAAACACATGCGTCAATNTTTACGCATGATTA
TCTTTAACGTACGTCGCAATATGATTATCTTTCTAGGGTTAAATAACTTCAGACATGTGA
TGGGGAACTAGAAAGTCACTAAAAGCAATTCATTTATGGTAATTCTTCGAGTGACAGGTT
AATCTCTTTCGAGTG
Sequence Comment iPCR (3' sequence). Insertion point based on Drosophila melanogaster genome annotation release 5.

CLOSE