Detailed Information [109749]
Strain Information
DGRC Number 109749
Genotype with FlyBase Link w[1118]; PBac{EGFP-IV}woc[KM0185]
Genotype w1118; PBac{EGFP-IV}wocKM0185
Break points/Insertion Site 97E11
Related Genes woc
Received Date 22 November 2012
Original Number 185
Chromosome 3R
Comments Sb floating. 7Nov2017 E.O.
Expression Photo: KM0185

Original Source Hiroshi Matsubayashi and Masa-Toshi Yamamoto, Kyoto Institute of Technology
Original Comments Insertion site: 3R:23085669 (based on Drosophila melanogaster genome annotation release 5)
Cytological map: 97E11
Inserted gene: woc
Protein trap?: Yes
Insertion into Intron or Exon?: Intron (CDS)
Orientation of piggyTrap (F:Forward/R:Reverse): F
Orientation of GFP exon and its frame against inserted gene: same orientation and frame
General Information Kyoto_piggyTrap
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Last update 2020-04-03
Research papers using this strain
[Please submit your publication]

Library & Clone Information
Insertion Point 3R:23085669
Chromosome Band 97E11
Flanking Sequence
TCTTCTTGNCCCCTTTTGTTATCTGAAGGAAGAAAAANTTAGCTGCAGATAAATAAACCT
CGATATACAGACCGATAAAACACATGCGTCAATCCTTACGCATGATTATCTTTAACGTAC
GTCGCAATATGATTATCTTTCTAGGGTTAAGCGAGCAGGTAAAAAAAAATTGCAAATACT
TCGTTTACGTTCAATATTTTAACACTTATTGCATGGCTATCATTCGATTGTAAAAACTTA
AAAAAAACCCAGTGT
Sequence Comment iPCR (3' sequence). Insertion point based on Drosophila melanogaster genome annotation release 5.

CLOSE