Detailed Information [109753]
Strain Information
DGRC Number 109753
Genotype with FlyBase Link w[1118] PBac{EGFP-IV}nonA[KM0061]
Genotype w1118 PBac{EGFP-IV}nonAKM0061
Break points/Insertion Site 14B18
Related Genes nonA
Received Date 22 November 2012
Original Number 61
Chromosome X
Comments Expression Photo: KM0061

Original Source Hiroshi Matsubayashi and Masa-Toshi Yamamoto, Kyoto Institute of Technology
Original Comments Insertion site: X:16256457 (based on Drosophila melanogaster genome annotation release 5)
Cytological map: 14B18
Inserted gene: nonA
Protein trap?: Yes
Insertion into Intron or Exon?: Intron (CDS)
Orientation of piggyTrap (F:Forward/R:Reverse): R
Orientation of GFP exon and its frame against inserted gene: same orientation and frame
General Information Kyoto_piggyTrap
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Last update 2020-04-03
Research papers using this strain
[Please submit your publication]

Library & Clone Information
Insertion Point X:16256457
Chromosome Band 14B18
Flanking Sequence
TNCTTNNGNCCNTTTTGTTTCTGAAGGAAGAAAAAATTAGCTGCAGATAAATAAACCTCG
ATATACAGACCGATAAAACACATGCGTCAATCTTTACGCATGATTATCTTTAACGTACGT
CGCAATATGATTATCTTTCTAGGGTTAAGGTGGGTACAAATACATATTGGCCCAATAAAT
AATGTTAATTCTTTTCTCTTAGAAAAGTCAAGAACATTTACTCGTTTATACATATGTACA
TACATATTTTCTACT
Sequence Comment iPCR (3' sequence). Insertion point based on Drosophila melanogaster genome annotation release 5.

CLOSE