Detailed Information [109757]
Strain Information
DGRC Number 109757
Genotype with FlyBase Link w[1118]; PBac{EGFP-IV}Sdc[KM0044]
Genotype w1118; PBac{EGFP-IV}SdcKM0044
Break points/Insertion Site 57E5
Related Genes Sdc
Received Date 22 November 2012
Original Number 44
Chromosome 2R
Comments Expression Photo: KM0044

Original Source Hiroshi Matsubayashi and Masa-Toshi Yamamoto, Kyoto Institute of Technology
Original Comments Insertion site: 2R:17355328 (based on Drosophila melanogaster genome annotation release 5)
Cytological map: 57E5
Inserted gene: Sdc
Protein trap?: Yes
Insertion into Intron or Exon?: Intron (CDS)
Orientation of piggyTrap (F:Forward/R:Reverse): F
Orientation of GFP exon and its frame against inserted gene: same orientation and frame
General Information Kyoto_piggyTrap
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Last update 2020-04-03
Research papers using this strain
[Please submit your publication]

Library & Clone Information
Insertion Point 2R:17355328
Chromosome Band 57E5
Flanking Sequence
ANACTTCCTGCGNACTTTTNNTNNTCTGNAAGNGCAGAAAAAATTAGCTGCAGATAAATA
AACCTNCGNTATACAGNCCGATAAAACACATGCAGTCAATTTTACGCATGATTATCTTTA
ACGTACGTCGCAATATGATTATCTTTCTAGGGTTAAGCAAGGTGTTTAAGATCTTGAAGN
TCACCTTGTTTTNNTTCTTCTGCTNGTCGGNCATGANATAGACGTTGTGGCTGNTGTCGT
CGTCCTCCAGCTTGC
Sequence Comment iPCR (3' sequence). Insertion point based on Drosophila melanogaster genome annotation release 5.

CLOSE