Detailed Information [109763]
Strain Information
DGRC Number 109763
Genotype with FlyBase Link w[1118]; PBac{EGFP-IV}vkg[KM0131]
Genotype w1118; PBac{EGFP-IV}vkgKM0131
Break points/Insertion Site 25C1
Related Genes vkg
Received Date 22 November 2012
Original Number 131
Chromosome 2L
Comments Expression Photo: KM0131

Original Source Hiroshi Matsubayashi and Masa-Toshi Yamamoto, Kyoto Institute of Technology
Original Comments Insertion site: 2L:5021283 (based on Drosophila melanogaster genome annotation release 5)
Cytological map: 25C1
Inserted gene: vkg
Protein trap?: Yes
Insertion into Intron or Exon?: Intron (CDS)
Orientation of piggyTrap (F:Forward/R:Reverse): F
Orientation of GFP exon and its frame against inserted gene: same orientation and frame
General Information Kyoto_piggyTrap
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Last update 2020-04-03
Research papers using this strain
[Please submit your publication]

Library & Clone Information
Insertion Point 2L:5021283
Chromosome Band 25C1
Flanking Sequence
NACTTGNGNNNANTTTTNTTATCTGAACANAGAAAAAATTAGCTGCAGATAAATAAACCT
CGATATACAGACCGATAAAACACATGCGTCAATTTTACGCATGATTATCTTTAACGTACG
TCGCAATATGATTATCTTTCTAGGGTTAATGCCAATTGCGCCAGTTGCCCGTCCAGCCAA
GCATTCAAGCATCCAANCTTTTGGTTTAAGGTCANGAGCGAGGNCTCCACGCGGATATAT
CTTGATATCTGGCAN
Sequence Comment iPCR (3' sequence). Insertion point based on Drosophila melanogaster genome annotation release 5.

CLOSE