Detailed Information [109765]
Strain Information
DGRC Number 109765
Genotype with FlyBase Link w[1118]; PBac{EGFP-IV}Tm1[KM0001] / TM6C, Sb[1]
Genotype w1118; PBac{EGFP-IV}Tm1KM0001 / TM6C, Sb1
Break points/Insertion Site 88E12
Related Genes Tm1
Received Date 22 November 2012
Original Number 1
Chromosome 3R
Original Source Hiroshi Matsubayashi and Masa-Toshi Yamamoto, Kyoto Institute of Technology
Original Comments Insertion site: 3R:11113028 (based on Drosophila melanogaster genome annotation release 5)
Cytological map: 88E12
Inserted gene: Tm1
Protein trap?: Yes
Insertion into Intron or Exon?: Intron (CDS), Exon(5'UTR)
Orientation of piggyTrap (F:Forward/R:Reverse): R
Orientation of GFP exon and its frame against inserted gene: same orientation and frame
General Information Kyoto_piggyTrap
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Lethality lethal
Last update 2020-04-03
Research papers using this strain
[Please submit your publication]

Library & Clone Information
Insertion Point 3R:11113028
Chromosome Band 88E12
Flanking Sequence
TGCGTCACTTTACGCAGNNTATCTTTCTAGGGTTAAATCATCAATAAAAATAGCCGAAAC
TAACGGTGCAATGAATCCAGCTGTTTGAAATCCGCAACATAAAAGCAAAAAACACAAAAC
TATAAAACAACACGCACCGAATCACACGGAAACAACAACAACAATAGGCATTGCTCATAA
TTAATATGTACGAGAAAACATTAAACATAGGAACTGCGAAAGTTAATAATGCATATGAAT
GGCAAAAAGTGAGAT
Sequence Comment iPCR (5' sequence). Insertion point based on Drosophila melanogaster genome annotation release 5.

CLOSE