Detailed Information [109766]
Strain Information
DGRC Number 109766
Genotype with FlyBase Link w[1118]; PBac{EGFP-IV}sm[KM0161]
Genotype w1118; PBac{EGFP-IV}smKM0161
Break points/Insertion Site 56E1
Related Genes sm
Received Date 22 November 2012
Original Number 161
Chromosome 2R
Comments Expression Photo: KM0161

Original Source Hiroshi Matsubayashi and Masa-Toshi Yamamoto, Kyoto Institute of Technology
Original Comments Insertion site: 2R:15491497 (based on Drosophila melanogaster genome annotation release 5)
Cytological map: 56E1
Inserted gene: sm
Protein trap?: Yes
Insertion into Intron or Exon?: Intron (CDS)
Orientation of piggyTrap (F:Forward/R:Reverse): F
Orientation of GFP exon and its frame against inserted gene: same orientation and frame
General Information Kyoto_piggyTrap
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Last update 2020-04-03
Research papers using this strain
[Please submit your publication]

Library & Clone Information
Insertion Point 2R:15491497
Chromosome Band 56E1
Flanking Sequence
GNTNAAACTTGTTGCCCCNNNNGATNTCTGAANNAAGAAAAANCTAGCTGCAGATAAATA
AACCTCGATATACAGACCGATAAAACACATGCGTCAATNCTTACGCATGATTATCTTTAA
CGTACGTCGCAATATGATTATCTTTCTAGGGTTAACATAAGTGTAACCGCAACTGATTTA
AATTAATAGCGAAACCGTAACGAAATTCATTAACCGAAACCACAGCATTTTCTTTATTTT
ATAATTGTTATCTCT
Sequence Comment iPCR (3' sequence). Insertion point based on Drosophila melanogaster genome annotation release 5.

CLOSE