Detailed Information [109767]
Strain Information
DGRC Number 109767
Genotype with FlyBase Link w[1118]; PBac{EGFP-IV}RpL5[KM0174] / SM6a
Genotype w1118; PBac{EGFP-IV}RpL5KM0174 / SM6a
Break points/Insertion Site 40F7
Related Genes RpL5
Received Date 22 November 2012
Original Number 174
Chromosome 2L
Original Source Hiroshi Matsubayashi and Masa-Toshi Yamamoto, Kyoto Institute of Technology
Original Comments Insertion site: 2L:22429317 (based on Drosophila melanogaster genome annotation release 5)
Cytological map: 40F7
Inserted gene: RpL5
Protein trap?: Yes
Insertion into Intron or Exon?: Intron (CDS/5'UTR), Exon(5'UTR)
Orientation of piggyTrap (F:Forward/R:Reverse): F
Orientation of GFP exon and its frame against inserted gene: same orientation and frame
General Information Kyoto_piggyTrap
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Lethality lethal
Last update 2020-04-03
Research papers using this strain
[Please submit your publication]
Pulianmackal AJ, Kanakousaki K, Flegel K, Grushko OG, Gourley E, Rozich E, Buttitta LA.
Misregulation of Nucleoporins 98 and 96 leads to defects in protein synthesis that promote hallmarks of tumorigenesis.
Dis Model Mech (2022) 15(3) [PubMed ID = 35107131] [RRC reference]

Library & Clone Information
Insertion Point 2L:22429317
Chromosome Band 40F7
Flanking Sequence
TTTCTTGCTCCCTTTTGTTATCTGAAGGAAGAAAAAATTAGCTGCAGATAAATAAACCTC
GATATACAGACCGATAAAACACATGCGTCAAANNTACGCATGATTATCTCCTAACGTACG
TCGCAATATGATCTATCTCCTCTAGGGTCTAAAATCACGTGGAGTAGAAATATTTTACAC
ATACCTCGCCGGAAATTGCTAGCAAAAAGAAGGAAAATAGTGCGGCCTTATTGGATCTTG
AAGTTCACCTTGATG
Sequence Comment iPCR (3' sequence). Insertion point based on Drosophila melanogaster genome annotation release 5.

CLOSE