| Strain Information | |
|---|---|
| DGRC Number | 109767 |
| Genotype with FlyBase Link | w[1118]; PBac{EGFP-IV}RpL5[KM0174] / SM6a |
| Genotype | w1118; PBac{EGFP-IV}RpL5KM0174 / SM6a |
| Break points/Insertion Site | 40F7 |
| Related Genes | RpL5 |
| Received Date | 22 November 2012 |
| Original Number | 174 |
| Chromosome | 2L |
| Original Source | Hiroshi Matsubayashi and Masa-Toshi Yamamoto, Kyoto Institute of Technology |
| Original Comments | Insertion site: 2L:22429317 (based on Drosophila melanogaster genome annotation release 5) Cytological map: 40F7 Inserted gene: RpL5 Protein trap?: Yes Insertion into Intron or Exon?: Intron (CDS/5'UTR), Exon(5'UTR) Orientation of piggyTrap (F:Forward/R:Reverse): F Orientation of GFP exon and its frame against inserted gene: same orientation and frame |
| General Information | Kyoto_piggyTrap |
| Genus | Drosophila |
| Subgenus | Sophophora |
| Species Group | melanogaster |
| Species Subgroup | melanogaster |
| Species | melanogaster |
| Lethality | lethal |
| Last update | 2020-04-03 |
| Research papers using this strain [Please submit your publication] |
Pulianmackal AJ, Kanakousaki K, Flegel K, Grushko OG, Gourley E, Rozich E, Buttitta LA. Misregulation of Nucleoporins 98 and 96 leads to defects in protein synthesis that promote hallmarks of tumorigenesis. Dis Model Mech (2022) 15(3) [PubMed ID = 35107131] [RRC reference] |
| Library & Clone Information |
|---|
| Insertion Point | 2L:22429317 |
| Chromosome Band | 40F7 |
| Flanking Sequence | TTTCTTGCTCCCTTTTGTTATCTGAAGGAAGAAAAAATTAGCTGCAGATAAATAAACCTC GATATACAGACCGATAAAACACATGCGTCAAANNTACGCATGATTATCTCCTAACGTACG TCGCAATATGATCTATCTCCTCTAGGGTCTAAAATCACGTGGAGTAGAAATATTTTACAC ATACCTCGCCGGAAATTGCTAGCAAAAAGAAGGAAAATAGTGCGGCCTTATTGGATCTTG AAGTTCACCTTGATG |
| Sequence Comment | iPCR (3' sequence). Insertion point based on Drosophila melanogaster genome annotation release 5. |