Detailed Information [109769]
Strain Information
DGRC Number 109769
Genotype with FlyBase Link w[1118] PBac{EGFP-IV}spoon[KM0168]
Genotype w1118 PBac{EGFP-IV}spoonKM0168
Break points/Insertion Site 4F9
Related Genes yu
Received Date 22 November 2012
Original Number 168
Chromosome X
Also known as CG3249
Original Source Hiroshi Matsubayashi and Masa-Toshi Yamamoto, Kyoto Institute of Technology
Original Comments Insertion site: X:5311886 (based on Drosophila melanogaster genome annotation release 5)
Cytological map: 4F9
Inserted gene: yu
Protein trap?: Yes
Insertion into Intron or Exon?: Intron (CDS/5'UTR)
Orientation of piggyTrap (F:Forward/R:Reverse): F
Orientation of GFP exon and its frame against inserted gene: same orientation and frame (N terminal fusion in 5'UTR)
General Information Kyoto_piggyTrap
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Last update 2020-04-03
Research papers using this strain
[Please submit your publication]

Library & Clone Information
Insertion Point X:5311886
Chromosome Band 4F9
Flanking Sequence
CTCTTGCNNCAACTGATATNAGAANNAAGAAAAAATAGNTGCAGATAAATAAACCTCGAT
ATACAGACCGATAAAACACATGCGTCAAANTTACGCATGATTATCTTTAACGTACGTCGC
AATATGATTATCTTTCTAGGGTTAAAGGTTTCGAATTGGTTTTGCAAGTCACGAGACCCG
CCTGCATGTGCTCGTCTGCATAAGTGTGCGTGTGTGCGTGTGTNTNTNNNNNNNNNNNNN
NNNNNNNNNNNNNNN
Sequence Comment iPCR (3' sequence). Insertion point based on Drosophila melanogaster genome annotation release 5.

CLOSE